Gene detail

Detail information of GWHGAAZE007468

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009624531.1	4.99699E-51	PREDICTED: ocs element-binding factor 1-like [Nicotiana tomentosiformis]
Swissprot	tr\|P24068\|OCS1_MAIZE	1E-20	Ocs element-binding factor 1
trEMBL	tr\|A0A068UG63\|A0A068UG63_COFCA	6E-50	Coffea canephora DH200=94 genomic scaffold, scaffold_26 {ECO:0000313\|EMBL:CDP07476.1}
TAIR10	AT1G75390.1	4E-32	basic leucine-zipper 44

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	45838635	45839033	+
GWHAAZE00000002	mRNA	45838635	45839033	+
GWHAAZE00000002	exon	45838635	45839033	+
GWHAAZE00000002	CDS	45838635	45839033	+

Transcript Sequence
>GWHTAAZE007476 ATGGATCAAAGAAAGAGAAAAAGAATGACATCGAATCGTGAATCAGCACGAAGATCGAGGATGCGGAAACAGAAGCACTTGGAAGATTTGGTGGTGCAAGCGAGTCAACTCAGTAAAGAGAACTCTCATATTCTCACAAACATGGAGGTTACTAGTCAGCTTTATGTGAAAATTGATGCTGAGAACTCTGTTCTTAGAGCCCAGATGGTTGAGTTGACTCACAGGCTAGAGTCTCTCAATGAGATCATTAGTTGCTTGGATTTAAATAATGGGTTCTTTGATTTTGATGAGGGTGGAAATGGAATGATGAGTGGTGGGGATGAGTTCTTGATTAATCCTTGGAATCTGATTCATGTTAATCAACCTATTATGGCCTCTGCAGATATGTTTATGGATTGA

Network for GWHGAAZE007468

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	4	49	9.60E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	1.043
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.538
	SRR3591710	White floral bud	0.302
	SRR3591711	White flower	1.229
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	7.128
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.011
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	2.368
	SRR8316904	Silver flowering stage	0.962
	SRR8316905	Silver flowering stage	0.450
	SRR8316906	Gold flowering stage	4.254
	SRR8316907	Gold flowering stage	9.816
	SRR8316908	Gold flowering stage	3.813
SRP132670	SRR6706286	Control	0.115
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.079
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.014
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.478
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.881
	CNS0095601	Golden flower (diploid) 1	0.620
	CNS0095602	Golden flower (diploid) 2	3.322
	CNS0095603	Golden flower (diploid) 3	3.226
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.522
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.376
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.236
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.798
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.156
	CNS0095610	Silvery flower (tetraploid) 1	12.280
	CNS0095611	Silvery flower (tetraploid) 2	7.568
	CNS0095612	Silvery flower (tetraploid) 3	10.654
	CNS0095613	Golden flower (tetraploid) 1	53.531
	CNS0095614	Golden flower (tetraploid) 2	36.759
	CNS0095615	Golden flower (tetraploid) 3	55.195
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.013
	CRR073299	Stem 3	0.006
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.014
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.707
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.006
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.494
	CRR073310	Second white 2	0.505
	CRR073311	Second white 3	1.260
	CRR073312	Silver flowering 1	3.214
	CRR073313	Silver flowering 2	3.707
	CRR073314	Silver flowering 3	3.583
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.008
	CRR073317	Gold flowering 3	0.105
	CRR073318	Tawny withering 1	0.011
	CRR073319	Tawny withering 2	0.074
	CRR073320	Tawny withering 3	0.000