Gene detail

Detail information of GWHGAAZE007503

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004133996.1	1.88381E-75	PREDICTED: V-type proton ATPase 16 kDa proteolipid subunit-like [Cucumis sativus]
Swissprot	tr\|Q43434\|VATL_GOSHI	4E-77	V-type proton ATPase 16 kDa proteolipid subunit
trEMBL	tr\|A0A0A0L6S2\|A0A0A0L6S2_CUCSA	7E-76	Vacuolar H+-ATPase c subunit {ECO:0000313\|EMBL:KGN56739.1}
TAIR10	AT1G19910.1	9E-61	ATPase, F0/V0 complex, subunit C protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	46531521	46532791	-
GWHAAZE00000002	mRNA	46531521	46532791	-
GWHAAZE00000002	exon	46531521	46531810	-
GWHAAZE00000002	exon	46532713	46532791	-
GWHAAZE00000002	CDS	46532713	46532791	-
GWHAAZE00000002	CDS	46531521	46531810	-

Transcript Sequence
>GWHTAAZE007511 ATGTCATCTGCGTTCAGCGGCGATGAAACGGCTCCGTTTTTCAGCTTCCTCGGTGCCGCAGCAGCCCTAGTCTTCTCATGCATGGGAGCAGCGTATGGGACGGCGAAGAGCGGAGTTGGTGTGGCTTCGATGGGAGTAATGAGGCCGGAGCTGGTTATGAAGTCAATTGTGCCTGTAGTTATGGCCGGTGTTTTAGGTATTTACGGTTTAATTATTGCTGTGATAATTAGTACTGGAATTAACCCCAAGGCCAAATCTTATTACCTTTTTGATGGTTACGCACACCTCTCGTCTAGACTCGCTTGTGGTCTGGCTGGGCTTTCGGCTGGAATGGCCATCGGAATTGTTGGCGATGCTGGTGTTAGGTAA

Network for GWHGAAZE007503

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00137.22	ATP-synt_C	17	76	4.30E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02155	ATPeV0C, ATP6L	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Phagosome	map04145
		Lysosome	map04142
		Collecting duct acid secretion	map04966
		Synaptic vesicle cycle	map04721

Gene Ontology

GO term	Ontology	Name
GO:1902600	biological_process	proton transmembrane transport
GO:0033179	cellular_component	proton-transporting V-type ATPase, V0 domain
GO:0033177	cellular_component	proton-transporting two-sector ATPase complex, proton-transporting domain
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.479
	SRR3591707	mature leaf	0.651
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.455
	SRR3591710	White floral bud	9.601
	SRR3591711	White flower	0.818
	SRR3591712	Green floral bud	12.977
	SRR3591713	Yellow flower	0.197
SRP173429	SRR8316895	Juvenile bud stage	0.098
	SRR8316896	Juvenile bud stage	0.438
	SRR8316897	Juvenile bud stage	0.423
	SRR8316894	Third green stage	0.336
	SRR8316900	Third green stage	4.064
	SRR8316901	Third green stage	3.142
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.029
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.142
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.259
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	2.493
	SRR6706287	Light intensity 50%	3.009
	SRR6706288	Light intensity 20%	2.500
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.089
	CNS0095593	Slightly white alabastrum(diploid) 2	0.582
	CNS0095594	Slightly white alabastrum(diploid) 3	0.252
	CNS0095595	Whole white alabastrum(diploid) 2	5.681
	CNS0095596	Whole white alabastrum(diploid) 3	6.052
	CNS0095597	Whole white alabastrum(diploid) 4	4.793
	CNS0095598	Silvery flower (diploied) 1	0.104
	CNS0095599	Silvery flower (diploied) 2	0.274
	CNS0095600	Silvery flower (diploied) 3	0.222
	CNS0095601	Golden flower (diploid) 1	0.617
	CNS0095602	Golden flower (diploid) 2	0.099
	CNS0095603	Golden flower (diploid) 3	0.592
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.559
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.754
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.069
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.216
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.889
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.800
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.074
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.374
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.118
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	2.294
	CRR073301	Leaf 2	0.905
	CRR073302	Leaf 3	1.012
	CRR073303	Juvenile bud 1	2.018
	CRR073304	Juvenile bud 2	4.249
	CRR073305	Juvenile bud 3	0.142
	CRR073306	Third green 1	0.622
	CRR073307	Third green 2	0.598
	CRR073308	Third green 3	0.083
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.085
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.792
	CRR073316	Gold flowering 2	0.643
	CRR073317	Gold flowering 3	0.317
	CRR073318	Tawny withering 1	0.236
	CRR073319	Tawny withering 2	0.875
	CRR073320	Tawny withering 3	1.410