Gene detail

Detail information of GWHGAAZE007669

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010649447.1	1.09798E-59	PREDICTED: HMG1/2-like protein isoform X2 [Vitis vinifera]
Swissprot	tr\|P93047\|HMGB3_ARATH	2E-49	High mobility group B protein 3
trEMBL	tr\|D7U469\|D7U469_VITVI	4E-60	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI37645.3}
TAIR10	AT1G20696.3	2E-28	high mobility group B3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	49920059	49921143	+
GWHAAZE00000002	mRNA	49920059	49921143	+
GWHAAZE00000002	exon	49920059	49920105	+
GWHAAZE00000002	exon	49920298	49920399	+
GWHAAZE00000002	exon	49920535	49920592	+
GWHAAZE00000002	exon	49920701	49920745	+
GWHAAZE00000002	exon	49920878	49920958	+
GWHAAZE00000002	exon	49921084	49921143	+
GWHAAZE00000002	CDS	49920059	49920105	+
GWHAAZE00000002	CDS	49920298	49920399	+
GWHAAZE00000002	CDS	49920535	49920592	+
GWHAAZE00000002	CDS	49920701	49920745	+
GWHAAZE00000002	CDS	49920878	49920958	+
GWHAAZE00000002	CDS	49921084	49921143	+

Transcript Sequence
>GWHTAAZE007677 ATGAAAGGAGGTAAATCCAAGGCGGAAACCAAAAAGGCTGAAAGCAAGAAGAGAGGTGAGAAAGCCGGTAAGCAGCCGGCGAAGAAGGCGAAGGCAGTGAAGGATCCTAATAAACCTAAGAGACCTGCAAGTGCTTTCTTTGTCTTCATGGAGGATTTTAGGAAGCAGTACAAAGAGAAACATCCGAACAACAAAGCTGTCTCTGTTGTCGGTAAAGCTGGTGGAGACAAATGGAAATCAATGTCTGAGGCTGATAAAGCACCCTATGTAGCTAAAGCAGAGAAAAGGAAGGTTGAGTATGAGAAGAATATGCAAGTCTACAACAAGAAACAGGTTGAGGGAAATGATGCAGCTGATGAGGAAGAGTCTGACAAGTCAAAGTCAGAAGTTCAC

Network for GWHGAAZE007669

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00505.20	HMG_box	39	108	1.20E-21

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HMG

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	316.567
	SRR3591706	second leaf	160.551
	SRR3591707	mature leaf	116.861
	SRR3591708	Shoot apex	610.802
	SRR3591709	Stem	208.888
	SRR3591710	White floral bud	380.721
	SRR3591711	White flower	346.123
	SRR3591712	Green floral bud	301.582
	SRR3591713	Yellow flower	228.552
SRP173429	SRR8316895	Juvenile bud stage	215.510
	SRR8316896	Juvenile bud stage	282.453
	SRR8316897	Juvenile bud stage	141.577
	SRR8316894	Third green stage	109.315
	SRR8316900	Third green stage	262.106
	SRR8316901	Third green stage	270.880
	SRR8316898	Complete white stage	154.501
	SRR8316899	Complete white stage	373.068
	SRR8316903	Complete white stage	289.611
	SRR8316902	Silver flowering stage	152.923
	SRR8316904	Silver flowering stage	179.205
	SRR8316905	Silver flowering stage	93.711
	SRR8316906	Gold flowering stage	193.330
	SRR8316907	Gold flowering stage	254.439
	SRR8316908	Gold flowering stage	201.901
SRP132670	SRR6706286	Control	284.250
	SRR6706287	Light intensity 50%	288.849
	SRR6706288	Light intensity 20%	288.475
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	264.333
	CNS0095593	Slightly white alabastrum(diploid) 2	265.346
	CNS0095594	Slightly white alabastrum(diploid) 3	252.725
	CNS0095595	Whole white alabastrum(diploid) 2	211.281
	CNS0095596	Whole white alabastrum(diploid) 3	183.543
	CNS0095597	Whole white alabastrum(diploid) 4	191.833
	CNS0095598	Silvery flower (diploied) 1	269.642
	CNS0095599	Silvery flower (diploied) 2	251.486
	CNS0095600	Silvery flower (diploied) 3	180.884
	CNS0095601	Golden flower (diploid) 1	185.594
	CNS0095602	Golden flower (diploid) 2	137.571
	CNS0095603	Golden flower (diploid) 3	144.467
	CNS0095604	Slightly white alabastrum(tetraploid) 1	200.066
	CNS0095605	Slightly white alabastrum(tetraploid) 2	193.762
	CNS0095606	Slightly white alabastrum(tetraploid) 3	242.452
	CNS0095607	Whole white alabastrum(tetraploid) 1	165.576
	CNS0095608	Whole white alabastrum(tetraploid) 2	145.862
	CNS0095609	Whole white alabastrum(tetraploid) 3	146.872
	CNS0095610	Silvery flower (tetraploid) 1	182.785
	CNS0095611	Silvery flower (tetraploid) 2	175.271
	CNS0095612	Silvery flower (tetraploid) 3	159.033
	CNS0095613	Golden flower (tetraploid) 1	116.728
	CNS0095614	Golden flower (tetraploid) 2	137.043
	CNS0095615	Golden flower (tetraploid) 3	34.455
CRA001975	CRR073297	Stem 1	358.142
	CRR073298	Stem 2	341.766
	CRR073299	Stem 3	371.737
	CRR073300	Leaf 1	244.365
	CRR073301	Leaf 2	270.622
	CRR073302	Leaf 3	257.308
	CRR073303	Juvenile bud 1	224.741
	CRR073304	Juvenile bud 2	240.334
	CRR073305	Juvenile bud 3	164.661
	CRR073306	Third green 1	121.323
	CRR073307	Third green 2	143.866
	CRR073308	Third green 3	135.083
	CRR073309	Second white 1	76.127
	CRR073310	Second white 2	126.763
	CRR073311	Second white 3	87.271
	CRR073312	Silver flowering 1	45.943
	CRR073313	Silver flowering 2	52.736
	CRR073314	Silver flowering 3	57.520
	CRR073315	Gold flowering 1	317.702
	CRR073316	Gold flowering 2	378.079
	CRR073317	Gold flowering 3	180.802
	CRR073318	Tawny withering 1	295.593
	CRR073319	Tawny withering 2	342.827
	CRR073320	Tawny withering 3	345.509