Gene detail

Detail information of GWHGAAZE007676

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002521730.1	6.5143E-106	50S robosomal protein L11, putative [Ricinus communis]
Swissprot	tr\|O78412\|RK11_GUITH	3E-30	50S ribosomal protein L11, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_00736}
trEMBL	tr\|B9S6W1\|B9S6W1_RICCO	2E-106	50S robosomal protein L11, putative {ECO:0000313\|EMBL:EEF40717.1}
TAIR10	AT4G35490.1	5E-62	mitochondrial ribosomal protein L11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	50051158	50051625	-
GWHAAZE00000002	mRNA	50051158	50051625	-
GWHAAZE00000002	exon	50051158	50051625	-
GWHAAZE00000002	CDS	50051158	50051625	-

Transcript Sequence
>GWHTAAZE007684 ATGGCAACCCTAAAAGAAATCCTAACTCGCCGTCCGGTAGCAGCAACAATCCGCCTCACTGTCCCTGCCGGTGGAGCACGGCCAGCACCACCTGTCGGTCCAGCCCTAGGTCAATACCGCCTAAACCTAATGGCATTTTGCAAGGACTTCAACGCACGTACTCAAAAATACAAGCCGGATACTCCAATGTCGGTCACAATCACAGCCTTCAAAGACAACACCTTCGAGTTCACCGTCAAATCGCCATCGGTCACCTGGTATTTGAAGAAAGCCGCTGGTATAGAGTCTGGTAGTAGTCGGCCTGGTCATGTTGTTGCTTCTACTTTGACAGTGAAGCATGTTTACGAGATTGCGAAGGTAAAGCAGTCTGATCCTTATTGTCAGTATATGTCTTTAGAGGCTATAAGTAAGTCAATTGTTGGTACTGCTAATAGTATGGGGATTCAGGTTCAAAAGGAGTTGGATTGA

Network for GWHGAAZE007676

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03946.15	Ribosomal_L11_N	13	75	1.70E-24
PF00298.20	Ribosomal_L11	80	150	1.70E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02867	RP-L11, MRPL11, rplK	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	18.406
	SRR3591706	second leaf	16.545
	SRR3591707	mature leaf	14.478
	SRR3591708	Shoot apex	22.391
	SRR3591709	Stem	17.947
	SRR3591710	White floral bud	25.087
	SRR3591711	White flower	34.570
	SRR3591712	Green floral bud	27.745
	SRR3591713	Yellow flower	35.169
SRP173429	SRR8316895	Juvenile bud stage	21.048
	SRR8316896	Juvenile bud stage	24.932
	SRR8316897	Juvenile bud stage	18.192
	SRR8316894	Third green stage	8.161
	SRR8316900	Third green stage	26.270
	SRR8316901	Third green stage	29.651
	SRR8316898	Complete white stage	8.029
	SRR8316899	Complete white stage	20.934
	SRR8316903	Complete white stage	16.447
	SRR8316902	Silver flowering stage	13.097
	SRR8316904	Silver flowering stage	15.598
	SRR8316905	Silver flowering stage	10.272
	SRR8316906	Gold flowering stage	26.046
	SRR8316907	Gold flowering stage	31.497
	SRR8316908	Gold flowering stage	31.406
SRP132670	SRR6706286	Control	14.984
	SRR6706287	Light intensity 50%	17.968
	SRR6706288	Light intensity 20%	19.075
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	28.539
	CNS0095593	Slightly white alabastrum(diploid) 2	31.446
	CNS0095594	Slightly white alabastrum(diploid) 3	33.075
	CNS0095595	Whole white alabastrum(diploid) 2	17.315
	CNS0095596	Whole white alabastrum(diploid) 3	20.495
	CNS0095597	Whole white alabastrum(diploid) 4	22.491
	CNS0095598	Silvery flower (diploied) 1	21.814
	CNS0095599	Silvery flower (diploied) 2	21.689
	CNS0095600	Silvery flower (diploied) 3	25.561
	CNS0095601	Golden flower (diploid) 1	24.960
	CNS0095602	Golden flower (diploid) 2	31.603
	CNS0095603	Golden flower (diploid) 3	29.247
	CNS0095604	Slightly white alabastrum(tetraploid) 1	33.341
	CNS0095605	Slightly white alabastrum(tetraploid) 2	32.029
	CNS0095606	Slightly white alabastrum(tetraploid) 3	43.752
	CNS0095607	Whole white alabastrum(tetraploid) 1	21.969
	CNS0095608	Whole white alabastrum(tetraploid) 2	21.055
	CNS0095609	Whole white alabastrum(tetraploid) 3	29.984
	CNS0095610	Silvery flower (tetraploid) 1	45.835
	CNS0095611	Silvery flower (tetraploid) 2	48.844
	CNS0095612	Silvery flower (tetraploid) 3	42.479
	CNS0095613	Golden flower (tetraploid) 1	49.473
	CNS0095614	Golden flower (tetraploid) 2	49.046
	CNS0095615	Golden flower (tetraploid) 3	45.802
CRA001975	CRR073297	Stem 1	18.164
	CRR073298	Stem 2	15.989
	CRR073299	Stem 3	25.657
	CRR073300	Leaf 1	18.224
	CRR073301	Leaf 2	20.328
	CRR073302	Leaf 3	18.752
	CRR073303	Juvenile bud 1	26.086
	CRR073304	Juvenile bud 2	19.800
	CRR073305	Juvenile bud 3	29.757
	CRR073306	Third green 1	35.321
	CRR073307	Third green 2	40.942
	CRR073308	Third green 3	30.132
	CRR073309	Second white 1	66.198
	CRR073310	Second white 2	34.751
	CRR073311	Second white 3	58.734
	CRR073312	Silver flowering 1	87.321
	CRR073313	Silver flowering 2	76.791
	CRR073314	Silver flowering 3	88.370
	CRR073315	Gold flowering 1	13.523
	CRR073316	Gold flowering 2	12.639
	CRR073317	Gold flowering 3	15.703
	CRR073318	Tawny withering 1	31.191
	CRR073319	Tawny withering 2	23.992
	CRR073320	Tawny withering 3	27.313