Gene detail

Detail information of GWHGAAZE007838

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO60669.1	3.40473E-50	hypothetical protein CISIN_1g0195702mg, partial [Citrus sinensis]
Swissprot	tr\|Q940J1\|ATB16_ARATH	3E-46	Homeobox-leucine zipper protein ATHB-16
trEMBL	tr\|A0A067EZZ0\|A0A067EZZ0_CITSI	1E-50	Uncharacterized protein {ECO:0000313\|EMBL:KDO60669.1} (Fragment)
TAIR10	AT4G40060.1	1E-37	homeobox protein 16

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	53964891	53965235	+
GWHAAZE00000002	mRNA	53964891	53965235	+
GWHAAZE00000002	exon	53964891	53965235	+
GWHAAZE00000002	CDS	53964891	53965235	+

Transcript Sequence
>GWHTAAZE007846 ATGGGGGAGAAAAAGAGGAGATTAAGGGTGGAGCAAGTGAAGGCATTGGAGAAGAATTTTGAGGTGGAAAATAAGCTGGAACCAGAGAGGAAAGTGAAGCTTGCTAATGAACTTGGATTGCAGCCGAGGCAGGTGGCTGTTTGGTTCCAGAACCGCCGTGCGCGGTGGAAGACTAAGCAATTGGAGAGGGATTATGGGGTTCTTAAGGCCAATTATGATGCCTTGAAGGTTAACTTTGAGAGGTTGCAGCAAGATAATGAAGCTATGCAGAAAGAGGTAGTTCTTCTATTCAATTCTGTACTTTCTGTTGGTAGTTTGTCTTTACTTTGTTCCAAGATTCAATAA

Network for GWHGAAZE007838

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	4	57	2.80E-16
PF02183.19	HALZ	59	96	3.60E-16

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-HD-ZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0043565	molecular_function	sequence-specific DNA binding
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	130.459
	SRR3591706	second leaf	112.192
	SRR3591707	mature leaf	349.917
	SRR3591708	Shoot apex	87.705
	SRR3591709	Stem	230.566
	SRR3591710	White floral bud	292.199
	SRR3591711	White flower	148.165
	SRR3591712	Green floral bud	206.044
	SRR3591713	Yellow flower	121.516
SRP173429	SRR8316895	Juvenile bud stage	68.399
	SRR8316896	Juvenile bud stage	86.133
	SRR8316897	Juvenile bud stage	32.593
	SRR8316894	Third green stage	71.270
	SRR8316900	Third green stage	169.570
	SRR8316901	Third green stage	120.590
	SRR8316898	Complete white stage	53.818
	SRR8316899	Complete white stage	178.281
	SRR8316903	Complete white stage	121.535
	SRR8316902	Silver flowering stage	21.907
	SRR8316904	Silver flowering stage	32.681
	SRR8316905	Silver flowering stage	16.548
	SRR8316906	Gold flowering stage	26.237
	SRR8316907	Gold flowering stage	38.885
	SRR8316908	Gold flowering stage	51.209
SRP132670	SRR6706286	Control	408.831
	SRR6706287	Light intensity 50%	336.101
	SRR6706288	Light intensity 20%	327.009
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	145.805
	CNS0095593	Slightly white alabastrum(diploid) 2	105.545
	CNS0095594	Slightly white alabastrum(diploid) 3	122.993
	CNS0095595	Whole white alabastrum(diploid) 2	92.493
	CNS0095596	Whole white alabastrum(diploid) 3	109.169
	CNS0095597	Whole white alabastrum(diploid) 4	108.578
	CNS0095598	Silvery flower (diploied) 1	147.372
	CNS0095599	Silvery flower (diploied) 2	54.888
	CNS0095600	Silvery flower (diploied) 3	70.705
	CNS0095601	Golden flower (diploid) 1	57.450
	CNS0095602	Golden flower (diploid) 2	83.265
	CNS0095603	Golden flower (diploid) 3	85.517
	CNS0095604	Slightly white alabastrum(tetraploid) 1	146.031
	CNS0095605	Slightly white alabastrum(tetraploid) 2	145.536
	CNS0095606	Slightly white alabastrum(tetraploid) 3	309.845
	CNS0095607	Whole white alabastrum(tetraploid) 1	99.406
	CNS0095608	Whole white alabastrum(tetraploid) 2	96.424
	CNS0095609	Whole white alabastrum(tetraploid) 3	200.678
	CNS0095610	Silvery flower (tetraploid) 1	158.978
	CNS0095611	Silvery flower (tetraploid) 2	90.412
	CNS0095612	Silvery flower (tetraploid) 3	104.719
	CNS0095613	Golden flower (tetraploid) 1	104.299
	CNS0095614	Golden flower (tetraploid) 2	139.266
	CNS0095615	Golden flower (tetraploid) 3	31.208
CRA001975	CRR073297	Stem 1	215.800
	CRR073298	Stem 2	230.955
	CRR073299	Stem 3	167.388
	CRR073300	Leaf 1	135.578
	CRR073301	Leaf 2	157.468
	CRR073302	Leaf 3	95.510
	CRR073303	Juvenile bud 1	126.940
	CRR073304	Juvenile bud 2	35.079
	CRR073305	Juvenile bud 3	132.405
	CRR073306	Third green 1	24.680
	CRR073307	Third green 2	37.524
	CRR073308	Third green 3	37.598
	CRR073309	Second white 1	1.323
	CRR073310	Second white 2	2.899
	CRR073311	Second white 3	3.644
	CRR073312	Silver flowering 1	1.672
	CRR073313	Silver flowering 2	2.097
	CRR073314	Silver flowering 3	1.408
	CRR073315	Gold flowering 1	156.854
	CRR073316	Gold flowering 2	246.387
	CRR073317	Gold flowering 3	46.316
	CRR073318	Tawny withering 1	102.649
	CRR073319	Tawny withering 2	55.591
	CRR073320	Tawny withering 3	77.156