Gene detail

Detail information of GWHGAAZE008007

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010320804.1	4.40315E-50	PREDICTED: choline/ethanolaminephosphotransferase 1-like [Solanum lycopersicum]
Swissprot	tr\|O82567\|AAPT1_ARATH	5E-49	Choline/ethanolaminephosphotransferase 1
trEMBL	tr\|K4AR37\|K4AR37_SOLLC	2E-50	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc00g059500.1.1}
TAIR10	AT1G13560.1	2E-41	aminoalcoholphosphotransferase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	59273684	59278189	+
GWHAAZE00000002	mRNA	59273684	59278189	+
GWHAAZE00000002	exon	59273684	59273820	+
GWHAAZE00000002	exon	59276009	59276069	+
GWHAAZE00000002	exon	59278004	59278189	+
GWHAAZE00000002	CDS	59273684	59273820	+
GWHAAZE00000002	CDS	59276009	59276069	+
GWHAAZE00000002	CDS	59278004	59278189	+

Transcript Sequence
>GWHTAAZE008015 ATGGGATATGTAGGGGCTCATGGTGTTGCAGCACTGCATAAATACAAGTACAGTGGTGTGGATCACTCATATCTTGCTAAGTATGTCTTACAGCCGTTTTGGACTCACAGTGTCAACTTCTTCCCTCTTTGGATGCCCTCTTTTCAGATTACACTTACAGGATTTATGTTCTTGGTCATATCTGCACTGCTTGGCTATATATATTCACCTTGCTTGGATACACCTCCACCGAGATGGGTTCATTTAGCACATGGTTTACTTCTCTTCTTATATCAGGTTGACTTAACCTTTCTACTACTGGTGATTGAGTCTGGTTCTTTTCTACTATATTGTTGCTTTTCATTTCTTTGTAATTTGGTGAGCCTGTCTGCTTCATTAGCTTAA

Network for GWHGAAZE008007

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00993	EPT1	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Glycerophospholipid metabolism	map00564
		Ether lipid metabolism	map00565
		Phosphonate and phosphinate metabolism	map00440

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.214
	SRR3591710	White floral bud	1.182
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	7.997
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	1.463
	SRR8316896	Juvenile bud stage	5.096
	SRR8316897	Juvenile bud stage	2.272
	SRR8316894	Third green stage	2.158
	SRR8316900	Third green stage	7.964
	SRR8316901	Third green stage	7.631
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.368
	SRR8316903	Complete white stage	0.073
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.057
	SRR6706287	Light intensity 50%	1.930
	SRR6706288	Light intensity 20%	1.393
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.395
	CNS0095593	Slightly white alabastrum(diploid) 2	4.663
	CNS0095594	Slightly white alabastrum(diploid) 3	2.292
	CNS0095595	Whole white alabastrum(diploid) 2	6.668
	CNS0095596	Whole white alabastrum(diploid) 3	6.372
	CNS0095597	Whole white alabastrum(diploid) 4	7.361
	CNS0095598	Silvery flower (diploied) 1	0.060
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.080
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.419
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.242
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.119
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.027
	CNS0095608	Whole white alabastrum(tetraploid) 2	16.359
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.030
	CNS0095610	Silvery flower (tetraploid) 1	0.070
	CNS0095611	Silvery flower (tetraploid) 2	0.389
	CNS0095612	Silvery flower (tetraploid) 3	0.248
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.260
CRA001975	CRR073297	Stem 1	0.483
	CRR073298	Stem 2	0.694
	CRR073299	Stem 3	0.180
	CRR073300	Leaf 1	2.609
	CRR073301	Leaf 2	1.123
	CRR073302	Leaf 3	1.360
	CRR073303	Juvenile bud 1	0.141
	CRR073304	Juvenile bud 2	0.471
	CRR073305	Juvenile bud 3	0.303
	CRR073306	Third green 1	0.113
	CRR073307	Third green 2	0.024
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.095
	CRR073312	Silver flowering 1	0.225
	CRR073313	Silver flowering 2	0.308
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.455
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.112
	CRR073319	Tawny withering 2	0.328
	CRR073320	Tawny withering 3	0.304