Gene detail

Detail information of GWHGAAZE008035

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AHX56187.1	2.52515E-86	lipoxygenase [Diospyros kaki]
Swissprot	tr\|Q43191\|LOX15_SOLTU	9E-82	Probable linoleate 9S-lipoxygenase 5
trEMBL	tr\|A0A067ZSZ0\|A0A067ZSZ0_DIOKA	9E-87	Lipoxygenase {ECO:0000256\|RuleBase:RU003975}
TAIR10	AT1G55020.1	1E-65	lipoxygenase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	59980918	59982025	-
GWHAAZE00000002	mRNA	59980918	59982025	-
GWHAAZE00000002	exon	59980918	59981208	-
GWHAAZE00000002	exon	59981339	59981446	-
GWHAAZE00000002	exon	59981652	59981729	-
GWHAAZE00000002	exon	59981966	59982025	-
GWHAAZE00000002	CDS	59981966	59982025	-
GWHAAZE00000002	CDS	59981652	59981729	-
GWHAAZE00000002	CDS	59981339	59981446	-
GWHAAZE00000002	CDS	59980918	59981208	-

Transcript Sequence
>GWHTAAZE008043 ATGCTCAAGCAACTTCTTCAAACGGACGGTGAAGGACTCGCCAAATTCCCCATGCCACAATCTGCATGGAGGAGAGACGAAGAATTCGCAAGGGAAATGTTAGCTGGAGTTAACCATGTCAGCATCCAATGTCTCAAGGAGTTTTCTCTAACAAGCAAGCTTGATCCTAAAGTCTATGGAAACCAAAACAGTTCAATAACCAAAAATCACATAGAGAATAAACTTGATGGGCTAACAATAGAAGAGGCAATCAGGAGTAATCGGCTGTTCATATTGGACCACCATGATAGTTTAATGCCATACAAAAGACGAATAAACTCAACGTCCACAAAAATGTACGCTACGAGGACTCTGCTTTTCTTGCAGAAAGACGGGACACTGAAACCATTAGTGATTAAACTAAGCTTGCCGAATCCACAAGGGGGTCAATTTGGTGCCGTTAGCAAAGTATTTACAGCAGTTGAAAATGGCGTCGAAGGTACCATTTGGCAATTGGCTAAAGCTTATTTTACAGTGAATGATTCGGGCGTTCATTAG

Network for GWHGAAZE008035

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00305.20	Lipoxygenase	2	178	1.60E-66

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15718	LOX1_5	Linoleic acid metabolism	map00591

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity
GO:0016702	molecular_function	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen
GO:0046872	molecular_function	metal ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	1.663
	SRR3591711	White flower	3.409
	SRR3591712	Green floral bud	3.615
	SRR3591713	Yellow flower	0.757
SRP173429	SRR8316895	Juvenile bud stage	6.607
	SRR8316896	Juvenile bud stage	7.317
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	2.727
	SRR8316900	Third green stage	4.363
	SRR8316901	Third green stage	4.650
	SRR8316898	Complete white stage	1.551
	SRR8316899	Complete white stage	4.934
	SRR8316903	Complete white stage	4.997
	SRR8316902	Silver flowering stage	1.978
	SRR8316904	Silver flowering stage	3.359
	SRR8316905	Silver flowering stage	1.851
	SRR8316906	Gold flowering stage	1.146
	SRR8316907	Gold flowering stage	3.445
	SRR8316908	Gold flowering stage	0.581
SRP132670	SRR6706286	Control	2.093
	SRR6706287	Light intensity 50%	2.652
	SRR6706288	Light intensity 20%	3.089
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.025
	CNS0095593	Slightly white alabastrum(diploid) 2	5.095
	CNS0095594	Slightly white alabastrum(diploid) 3	8.661
	CNS0095595	Whole white alabastrum(diploid) 2	2.911
	CNS0095596	Whole white alabastrum(diploid) 3	3.188
	CNS0095597	Whole white alabastrum(diploid) 4	3.017
	CNS0095598	Silvery flower (diploied) 1	2.769
	CNS0095599	Silvery flower (diploied) 2	1.956
	CNS0095600	Silvery flower (diploied) 3	2.443
	CNS0095601	Golden flower (diploid) 1	3.173
	CNS0095602	Golden flower (diploid) 2	1.173
	CNS0095603	Golden flower (diploid) 3	1.441
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	4.650
	CRR073298	Stem 2	4.179
	CRR073299	Stem 3	1.061
	CRR073300	Leaf 1	4.218
	CRR073301	Leaf 2	2.474
	CRR073302	Leaf 3	1.030
	CRR073303	Juvenile bud 1	3.418
	CRR073304	Juvenile bud 2	0.814
	CRR073305	Juvenile bud 3	0.208
	CRR073306	Third green 1	0.231
	CRR073307	Third green 2	0.074
	CRR073308	Third green 3	0.472
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.126
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.982
	CRR073315	Gold flowering 1	0.238
	CRR073316	Gold flowering 2	1.358
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.410
	CRR073319	Tawny withering 2	1.029
	CRR073320	Tawny withering 3	0.351