Gene detail

Detail information of GWHGAAZE008226

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006404529.1	1.57691E-16	hypothetical protein EUTSA_v10000639mg, partial [Eutrema salsugineum]
Swissprot	tr\|O24370\|LOX21_SOLTU	2E-14	Linoleate 13S-lipoxygenase 2-1, chloroplastic (Precursor)
trEMBL	tr\|V4LU46\|V4LU46_EUTSA	6E-17	Uncharacterized protein {ECO:0000313\|EMBL:ESQ45982.1} (Fragment)
TAIR10	AT3G45140.1	9E-10	lipoxygenase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	65635650	65636722	+
GWHAAZE00000002	mRNA	65635650	65636722	+
GWHAAZE00000002	exon	65635650	65635707	+
GWHAAZE00000002	exon	65635903	65635989	+
GWHAAZE00000002	exon	65636363	65636448	+
GWHAAZE00000002	exon	65636711	65636722	+
GWHAAZE00000002	CDS	65635650	65635707	+
GWHAAZE00000002	CDS	65635903	65635989	+
GWHAAZE00000002	CDS	65636363	65636448	+
GWHAAZE00000002	CDS	65636711	65636722	+

Transcript Sequence
>GWHTAAZE008234 AGCACGGAGTACGCATACCCGAGACGTTGTAGAACAGGTCGCCCACGGTGCAAGATAGATCCATCGTCAGAGTCGAGGAGTGACGAGATTTACCTGCCGAGGGATGAAGAATTTTCGGAGGTGAAAAGTCAGTCGTTCCAATTGAGAGACAGATTTTCTTGGCATAGGGATGAGGAATTTTGTCGACAAACACTAGCTGGTCTCAACCCATGTAGTATCCAGTTGTTGCAGGAGTGGCTATGA

Network for GWHGAAZE008226

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00305.20	Lipoxygenase	2	47	9.60E-14
PF00305.20	Lipoxygenase	49	79	9.40E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00454	LOX2S	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Linoleic acid metabolism	map00591
		alpha-Linolenic acid metabolism	map00592

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016702	molecular_function	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen
GO:0046872	molecular_function	metal ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.101
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.611
SRP173429	SRR8316895	Juvenile bud stage	5.826
	SRR8316896	Juvenile bud stage	7.169
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	1.951
	SRR8316900	Third green stage	2.746
	SRR8316901	Third green stage	2.473
	SRR8316898	Complete white stage	0.211
	SRR8316899	Complete white stage	0.213
	SRR8316903	Complete white stage	0.211
	SRR8316902	Silver flowering stage	0.719
	SRR8316904	Silver flowering stage	0.409
	SRR8316905	Silver flowering stage	0.350
	SRR8316906	Gold flowering stage	0.348
	SRR8316907	Gold flowering stage	0.636
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.051
	SRR6706287	Light intensity 50%	0.582
	SRR6706288	Light intensity 20%	0.546
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.146
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.158
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.158
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.391
	CNS0095611	Silvery flower (tetraploid) 2	0.288
	CNS0095612	Silvery flower (tetraploid) 3	3.464
	CNS0095613	Golden flower (tetraploid) 1	1.652
	CNS0095614	Golden flower (tetraploid) 2	0.026
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	4.270
	CRR073298	Stem 2	5.679
	CRR073299	Stem 3	4.009
	CRR073300	Leaf 1	0.403
	CRR073301	Leaf 2	1.809
	CRR073302	Leaf 3	2.485
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.793
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.779
	CRR073309	Second white 1	0.091
	CRR073310	Second white 2	3.198
	CRR073311	Second white 3	0.050
	CRR073312	Silver flowering 1	0.099
	CRR073313	Silver flowering 2	0.766
	CRR073314	Silver flowering 3	0.137
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000