Gene detail

Detail information of GWHGAAZE008273

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009143031.1	1.92678E-13	PREDICTED: beta-glucosidase 15-like [Brassica rapa]
Swissprot	tr\|B3H5Q1\|BGL11_ARATH	7E-14	Beta-glucosidase 11 (Precursor)
trEMBL	tr\|M5WF34\|M5WF34_PRUPE	1E-13	Uncharacterized protein {ECO:0000313\|EMBL:EMJ07878.1} (Fragment)
TAIR10	AT1G02850.4	1E-12	beta glucosidase 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	68072560	68074614	+
GWHAAZE00000002	mRNA	68072560	68074614	+
GWHAAZE00000002	exon	68072560	68072686	+
GWHAAZE00000002	exon	68074349	68074614	+
GWHAAZE00000002	CDS	68072560	68072686	+
GWHAAZE00000002	CDS	68074349	68074614	+

Transcript Sequence
>GWHTAAZE008281 ATGGCAGGATTGTTGCTGGGGAATGCTATTGACCAATATCATCGATACAAGGAGGACGTAGCTTTGATGAAGTGGATGGGTTTGGACGCTTACAGATTTTCAATCTCGTGGTCCAGAATATTGCCAAGTTTTAGATCCAGTATTATACGGTCATTATCCTGCTCCGTGCAAGAGGTAATGAAGAAGCGTCTTCCGTCGTTTACACAACAGGAATCCAAAATGTTGACTAAATCATTGGATTTTCTGGGAATAAATTACTACACTGCTAGTTATGTGCGTGATGCATCAGATGTCATAATTCCAGGAGGAAAAGAAAGTTACATTACGGATTCAAAGGTTGAATATCCTCCTAAATTTCTTCTTGGTGATGATTGGGGTGCTAAATTGGCTTAA

Network for GWHGAAZE008273

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0058

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00232.19	Glyco_hydro_1	9	47	7.40E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.119
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.106
	SRR3591708	Shoot apex	11.437
	SRR3591709	Stem	0.123
	SRR3591710	White floral bud	0.362
	SRR3591711	White flower	3.419
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	10.705
SRP173429	SRR8316895	Juvenile bud stage	5.754
	SRR8316896	Juvenile bud stage	3.694
	SRR8316897	Juvenile bud stage	1.216
	SRR8316894	Third green stage	0.700
	SRR8316900	Third green stage	2.790
	SRR8316901	Third green stage	3.873
	SRR8316898	Complete white stage	27.132
	SRR8316899	Complete white stage	5.668
	SRR8316903	Complete white stage	35.901
	SRR8316902	Silver flowering stage	44.002
	SRR8316904	Silver flowering stage	49.537
	SRR8316905	Silver flowering stage	15.779
	SRR8316906	Gold flowering stage	22.235
	SRR8316907	Gold flowering stage	20.175
	SRR8316908	Gold flowering stage	22.913
SRP132670	SRR6706286	Control	1.298
	SRR6706287	Light intensity 50%	2.711
	SRR6706288	Light intensity 20%	1.877
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.383
	CNS0095593	Slightly white alabastrum(diploid) 2	0.183
	CNS0095594	Slightly white alabastrum(diploid) 3	0.400
	CNS0095595	Whole white alabastrum(diploid) 2	0.365
	CNS0095596	Whole white alabastrum(diploid) 3	0.040
	CNS0095597	Whole white alabastrum(diploid) 4	0.371
	CNS0095598	Silvery flower (diploied) 1	1.129
	CNS0095599	Silvery flower (diploied) 2	1.210
	CNS0095600	Silvery flower (diploied) 3	42.924
	CNS0095601	Golden flower (diploid) 1	1.574
	CNS0095602	Golden flower (diploid) 2	12.253
	CNS0095603	Golden flower (diploid) 3	10.678
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.345
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.002
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.391
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.144
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.435
	CNS0095610	Silvery flower (tetraploid) 1	50.514
	CNS0095611	Silvery flower (tetraploid) 2	106.654
	CNS0095612	Silvery flower (tetraploid) 3	73.343
	CNS0095613	Golden flower (tetraploid) 1	11.530
	CNS0095614	Golden flower (tetraploid) 2	14.633
	CNS0095615	Golden flower (tetraploid) 3	32.169
CRA001975	CRR073297	Stem 1	1.496
	CRR073298	Stem 2	1.146
	CRR073299	Stem 3	1.572
	CRR073300	Leaf 1	0.394
	CRR073301	Leaf 2	0.480
	CRR073302	Leaf 3	0.770
	CRR073303	Juvenile bud 1	0.750
	CRR073304	Juvenile bud 2	10.875
	CRR073305	Juvenile bud 3	1.780
	CRR073306	Third green 1	27.558
	CRR073307	Third green 2	4.060
	CRR073308	Third green 3	9.695
	CRR073309	Second white 1	15.165
	CRR073310	Second white 2	8.290
	CRR073311	Second white 3	13.564
	CRR073312	Silver flowering 1	2.060
	CRR073313	Silver flowering 2	0.394
	CRR073314	Silver flowering 3	3.863
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.054
	CRR073318	Tawny withering 1	0.477
	CRR073319	Tawny withering 2	0.280
	CRR073320	Tawny withering 3	0.326