Gene detail

Detail information of GWHGAAZE008493

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011089169.1	4.08808E-63	PREDICTED: beta-amyrin 28-oxidase-like [Sesamum indicum]
Swissprot	tr\|I7C6E8\|C7A52_PANGI	2E-40	Beta-amyrin 28-oxidase
trEMBL	tr\|A0A022RGD5\|A0A022RGD5_ERYGU	3E-60	Uncharacterized protein {ECO:0000313\|EMBL:EYU39276.1} (Fragment)
TAIR10	AT5G36110.1	2E-34	cytochrome P450, family 716, subfamily A, polypeptide 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	77757202	77758034	-
GWHAAZE00000002	mRNA	77757202	77758034	-
GWHAAZE00000002	exon	77757202	77757534	-
GWHAAZE00000002	exon	77757798	77758034	-
GWHAAZE00000002	CDS	77757798	77758034	-
GWHAAZE00000002	CDS	77757202	77757534	-

Transcript Sequence
>GWHTAAZE008501 ATGTTCTCTCTCTCAGTTTCATTAATCCTTGTTCTCCTCTTCCTTATGTTCACTTTTCTTCTCTTCATCACCACCAAAGTCATAATAAATCCCAGCTACTACTCATCTGCTAATCTTCCTCCAGGAACCTTCGGATGGCCGGTAATCGGAGAAACTCTTCAGCTCCTCCGGGCAGCCCGGAGCGGAAAACCGGAGAAATTCATGCAAGAAAGAGTGGAGAGGCACAGTTGCCCTCAGGTATTCAAGACCTCCTTGTTCGGAGAGAAGGTGGCAGTCTTGTGTGGGCCTGCCGGGAACAAGTTCCTGTTTGGTAACGAGAATAAACATGTCGCGGTTTGGTGGCCAAGTTCAATGAGAAAGGTGTTTGGGGAGTGTTTGTTAACAAGTGTAGGGGAGGAAGCAAAATGGATGAGGAAAATGCTATCCTCGTTTCTTACTCCCGATGCTTTCACCCGCCTCTACATCACAACCATGGGTGAGGTGACGCAGCAGCATATCAAAACCCATTGGCAAGGTAAAGAACACCTCACTCAAGCTGCTAATTTTAGACTCGCAAACAGTGCCACCTAA

Network for GWHGAAZE008493

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.130
	SRR3591706	second leaf	12.349
	SRR3591707	mature leaf	6.465
	SRR3591708	Shoot apex	11.057
	SRR3591709	Stem	0.186
	SRR3591710	White floral bud	0.869
	SRR3591711	White flower	1.091
	SRR3591712	Green floral bud	0.385
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.256
	SRR8316896	Juvenile bud stage	0.808
	SRR8316897	Juvenile bud stage	0.132
	SRR8316894	Third green stage	0.055
	SRR8316900	Third green stage	0.225
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.247
	SRR8316903	Complete white stage	0.454
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.070
	SRR6706288	Light intensity 20%	0.105
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.434
	CNS0095594	Slightly white alabastrum(diploid) 3	0.206
	CNS0095595	Whole white alabastrum(diploid) 2	0.391
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.293
	CNS0095598	Silvery flower (diploied) 1	1.223
	CNS0095599	Silvery flower (diploied) 2	0.530
	CNS0095600	Silvery flower (diploied) 3	0.102
	CNS0095601	Golden flower (diploid) 1	1.264
	CNS0095602	Golden flower (diploid) 2	0.404
	CNS0095603	Golden flower (diploid) 3	0.823
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.791
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.331
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.352
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.441
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.114
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.088
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.062
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.148
	CRR073298	Stem 2	0.124
	CRR073299	Stem 3	0.916
	CRR073300	Leaf 1	0.506
	CRR073301	Leaf 2	0.357
	CRR073302	Leaf 3	0.399
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.116
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	2.327
	CRR073316	Gold flowering 2	1.067
	CRR073317	Gold flowering 3	1.184
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000