Gene detail

Detail information of GWHGAAZE008559

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI40040.3	1.11571E-26	unnamed protein product [Vitis vinifera]
Swissprot	tr\|Q9SE94\|MTHR1_MAIZE	1E-28	Methylenetetrahydrofolate reductase 1
trEMBL	tr\|M1C551\|M1C551_SOLTU	4E-27	Methylenetetrahydrofolate reductase {ECO:0000256\|RuleBase:RU003862}
TAIR10	AT3G59970.3	2E-24	methylenetetrahydrofolate reductase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	82681686	82686484	+
GWHAAZE00000002	mRNA	82681686	82686484	+
GWHAAZE00000002	exon	82681686	82681870	+
GWHAAZE00000002	exon	82686298	82686484	+
GWHAAZE00000002	CDS	82681686	82681870	+
GWHAAZE00000002	CDS	82686298	82686484	+

Transcript Sequence
>GWHTAAZE008567 ATGCAGAATATGGGGTGCGTCGAGACTATGATGCATCTCACCTGCACTAACATGCCAGTCGAGAAGATCGATCATGCCTTGGATACTATAAAGTCTAATGGCATTCAGAATGTTCTTGCATTGAGAGGTGATCCGCCTCATAGACAGGATAAGTTTGTTGTGGTTTTGCGTGTGCCTTGGATCTCGATGGGGGGACCAGGTGGGTATGTGTATCGAAAGGCATATGTGGAGTTTTTCTACTCGGCGGAGAAGTTGAATGCGTTAGTTGAGAAATGCAAGGCGTTCGCGTCTCCAACGTACATGGCAGTGGATAAAGAAGGGAGTAGTTGGATATCTAACGTAAATGAAACAGGCATGAACGCAGTGACATAG

Network for GWHGAAZE008559

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02219.18	MTHFR	1	52	2.60E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00297	metF, MTHFR	Metabolic pathways	map01100
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		Carbon fixation pathways in prokaryotes	map00720
		One carbon pool by folate	map00670

Gene Ontology

GO term	Ontology	Name
GO:0006555	biological_process	methionine metabolic process
GO:0055114	biological_process	oxidation-reduction process
GO:0004489	molecular_function	methylenetetrahydrofolate reductase (NAD(P)H) activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.697
	SRR3591706	second leaf	9.803
	SRR3591707	mature leaf	9.337
	SRR3591708	Shoot apex	3.306
	SRR3591709	Stem	0.178
	SRR3591710	White floral bud	1.733
	SRR3591711	White flower	0.213
	SRR3591712	Green floral bud	2.433
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	2.835
	SRR8316896	Juvenile bud stage	1.476
	SRR8316897	Juvenile bud stage	0.166
	SRR8316894	Third green stage	1.208
	SRR8316900	Third green stage	6.365
	SRR8316901	Third green stage	6.073
	SRR8316898	Complete white stage	0.010
	SRR8316899	Complete white stage	1.521
	SRR8316903	Complete white stage	0.248
	SRR8316902	Silver flowering stage	0.200
	SRR8316904	Silver flowering stage	0.200
	SRR8316905	Silver flowering stage	0.032
	SRR8316906	Gold flowering stage	0.311
	SRR8316907	Gold flowering stage	0.066
	SRR8316908	Gold flowering stage	0.806
SRP132670	SRR6706286	Control	6.355
	SRR6706287	Light intensity 50%	6.589
	SRR6706288	Light intensity 20%	8.243
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.285
	CNS0095593	Slightly white alabastrum(diploid) 2	1.517
	CNS0095594	Slightly white alabastrum(diploid) 3	2.078
	CNS0095595	Whole white alabastrum(diploid) 2	4.175
	CNS0095596	Whole white alabastrum(diploid) 3	5.235
	CNS0095597	Whole white alabastrum(diploid) 4	3.343
	CNS0095598	Silvery flower (diploied) 1	2.984
	CNS0095599	Silvery flower (diploied) 2	1.143
	CNS0095600	Silvery flower (diploied) 3	1.084
	CNS0095601	Golden flower (diploid) 1	0.087
	CNS0095602	Golden flower (diploid) 2	0.213
	CNS0095603	Golden flower (diploid) 3	0.333
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.168
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.175
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.485
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.013
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.655
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.736
	CNS0095610	Silvery flower (tetraploid) 1	2.065
	CNS0095611	Silvery flower (tetraploid) 2	2.188
	CNS0095612	Silvery flower (tetraploid) 3	0.937
	CNS0095613	Golden flower (tetraploid) 1	0.661
	CNS0095614	Golden flower (tetraploid) 2	0.904
	CNS0095615	Golden flower (tetraploid) 3	0.081
CRA001975	CRR073297	Stem 1	3.721
	CRR073298	Stem 2	3.348
	CRR073299	Stem 3	4.130
	CRR073300	Leaf 1	2.594
	CRR073301	Leaf 2	3.297
	CRR073302	Leaf 3	2.778
	CRR073303	Juvenile bud 1	1.150
	CRR073304	Juvenile bud 2	2.547
	CRR073305	Juvenile bud 3	0.692
	CRR073306	Third green 1	0.906
	CRR073307	Third green 2	0.646
	CRR073308	Third green 3	0.884
	CRR073309	Second white 1	0.407
	CRR073310	Second white 2	0.071
	CRR073311	Second white 3	0.036
	CRR073312	Silver flowering 1	0.242
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.461
	CRR073316	Gold flowering 2	1.335
	CRR073317	Gold flowering 3	1.898
	CRR073318	Tawny withering 1	0.004
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000