Gene detail

Detail information of GWHGAAZE008560

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011080486.1	4.2364E-110	PREDICTED: THO complex subunit 7A [Sesamum indicum]
Swissprot	tr\|Q8LDS5\|THO7A_ARATH	6E-91	THO complex subunit 7A
trEMBL	tr\|D7T1C3\|D7T1C3_VITVI	3E-109	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI24303.3}
TAIR10	AT5G16790.1	4E-67	Tho complex subunit 7/Mft1p

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	82699284	82699940	-
GWHAAZE00000002	mRNA	82699284	82699940	-
GWHAAZE00000002	exon	82699284	82699940	-
GWHAAZE00000002	CDS	82699284	82699940	-

Transcript Sequence
>GWHTAAZE008568 ATGTTGGTAAAAGGTAGGAAAGTTACCAGTAGGGGAGAGGCCATGACTGCACATTACGCTTTTGGCCAATACGAAGATGACCCGATTATCAAGCACAGGCTACTCACTCGCACTACTACCACCAGGGGTGAACCTCCATTGAAAAAACTTCAAAAGAAATTTACCTCATTTGCCCTCGAGATCGAGAAGGATGCTGACAACTATGGCGATTGTGAAAGACTTGCCAAAGCTTTCTTGCAAGAGTTGACGACTTTTGAACTTCCACTGCTTAAGAGCAAAGCGGTTGTGGATGCAAACCTTAGAGAGAAGGAGAACTTTGAGGAGTTAAAAGATGATATAAACAGGCAAATATTACAGGCACAGGATGATATAGAAGATTTGAAGAAACAACTTGAAGATAGCAAGATTGAAAGGCACCACAAGGAGGAGTGCGAGACAATCAGGAAGTTAATTGCTACACAACCCCCGAGATCTGAGACACAGAAAGTTATAACGGAACTAGAGAGGGAGATTGCTCTGTTGGAGGCTGAGAACGTTGCTGGTTCAAGGACCTTGGAACTTCGCAAGAAGCAGTTTGCTCTTCTTTTGCACGTGGTATGTACCAATGTTTATAAAGTCCTTTTTTTGGGGGTAAAAAAGAAAAATTGGTATTGCTAG

Network for GWHGAAZE008560

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05615.14	THOC7	28	163	2.50E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13176	THOC7	RNA transport	map03013

Gene Ontology

GO term	Ontology	Name
GO:0006397	biological_process	mRNA processing
GO:0000445	cellular_component	THO complex part of transcription export complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	37.062
	SRR3591706	second leaf	25.982
	SRR3591707	mature leaf	22.769
	SRR3591708	Shoot apex	39.938
	SRR3591709	Stem	29.115
	SRR3591710	White floral bud	40.537
	SRR3591711	White flower	55.226
	SRR3591712	Green floral bud	37.653
	SRR3591713	Yellow flower	53.304
SRP173429	SRR8316895	Juvenile bud stage	33.995
	SRR8316896	Juvenile bud stage	45.721
	SRR8316897	Juvenile bud stage	18.450
	SRR8316894	Third green stage	16.828
	SRR8316900	Third green stage	49.101
	SRR8316901	Third green stage	44.495
	SRR8316898	Complete white stage	23.976
	SRR8316899	Complete white stage	66.853
	SRR8316903	Complete white stage	36.028
	SRR8316902	Silver flowering stage	36.064
	SRR8316904	Silver flowering stage	37.434
	SRR8316905	Silver flowering stage	18.438
	SRR8316906	Gold flowering stage	57.398
	SRR8316907	Gold flowering stage	62.279
	SRR8316908	Gold flowering stage	42.631
SRP132670	SRR6706286	Control	60.229
	SRR6706287	Light intensity 50%	59.613
	SRR6706288	Light intensity 20%	60.395
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	37.133
	CNS0095593	Slightly white alabastrum(diploid) 2	35.949
	CNS0095594	Slightly white alabastrum(diploid) 3	34.969
	CNS0095595	Whole white alabastrum(diploid) 2	32.207
	CNS0095596	Whole white alabastrum(diploid) 3	23.566
	CNS0095597	Whole white alabastrum(diploid) 4	29.994
	CNS0095598	Silvery flower (diploied) 1	34.230
	CNS0095599	Silvery flower (diploied) 2	39.788
	CNS0095600	Silvery flower (diploied) 3	46.829
	CNS0095601	Golden flower (diploid) 1	30.353
	CNS0095602	Golden flower (diploid) 2	39.939
	CNS0095603	Golden flower (diploid) 3	37.467
	CNS0095604	Slightly white alabastrum(tetraploid) 1	35.393
	CNS0095605	Slightly white alabastrum(tetraploid) 2	33.055
	CNS0095606	Slightly white alabastrum(tetraploid) 3	43.335
	CNS0095607	Whole white alabastrum(tetraploid) 1	27.940
	CNS0095608	Whole white alabastrum(tetraploid) 2	24.568
	CNS0095609	Whole white alabastrum(tetraploid) 3	31.505
	CNS0095610	Silvery flower (tetraploid) 1	49.819
	CNS0095611	Silvery flower (tetraploid) 2	40.010
	CNS0095612	Silvery flower (tetraploid) 3	34.149
	CNS0095613	Golden flower (tetraploid) 1	30.421
	CNS0095614	Golden flower (tetraploid) 2	35.900
	CNS0095615	Golden flower (tetraploid) 3	34.608
CRA001975	CRR073297	Stem 1	48.827
	CRR073298	Stem 2	46.894
	CRR073299	Stem 3	55.757
	CRR073300	Leaf 1	37.848
	CRR073301	Leaf 2	42.874
	CRR073302	Leaf 3	37.911
	CRR073303	Juvenile bud 1	45.534
	CRR073304	Juvenile bud 2	43.687
	CRR073305	Juvenile bud 3	41.250
	CRR073306	Third green 1	38.313
	CRR073307	Third green 2	40.458
	CRR073308	Third green 3	38.848
	CRR073309	Second white 1	28.472
	CRR073310	Second white 2	39.575
	CRR073311	Second white 3	25.015
	CRR073312	Silver flowering 1	28.279
	CRR073313	Silver flowering 2	26.772
	CRR073314	Silver flowering 3	29.160
	CRR073315	Gold flowering 1	39.750
	CRR073316	Gold flowering 2	43.701
	CRR073317	Gold flowering 3	27.452
	CRR073318	Tawny withering 1	39.753
	CRR073319	Tawny withering 2	41.791
	CRR073320	Tawny withering 3	42.097