Gene detail

Detail information of GWHGAAZE008759

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAN72978.1	2.03385E-66	hypothetical protein VITISV_009029 [Vitis vinifera]
Swissprot	tr\|P26861\|RM06_MARPO	1E-48	60S ribosomal protein L6, mitochondrial
trEMBL	tr\|A5C2I3\|A5C2I3_VITVI	8E-67	Putative uncharacterized protein {ECO:0000313\|EMBL:CAN72978.1}
TAIR10	AT2G18400.1	3E-44	ribosomal protein L6 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	90574210	90574518	-
GWHAAZE00000002	mRNA	90574210	90574518	-
GWHAAZE00000002	exon	90574210	90574518	-
GWHAAZE00000002	CDS	90574210	90574518	-

Transcript Sequence
>GWHTAAZE008769 ATGGAAGCAAAGTTCTTCCGGTTTCTTAAGATTGTGGGAGTGGGATTCAAAGCAAGAGCAGAATCAGAAGGGCGTCTATTGTACCTTAAACTGGGATACAGCCACGAGGTAGAACTAACAGTGCCGCCGGCTGTACGCGTGTTTTGCTTTAAACCGAACGTAGTTTGCTGCACCGGGATTGACAAGCAAAGGGTGCACCAGTTTGCTGCTGCTGTCCGCAGTTGTAAGCCTCCAGAGGTTTACAAAGGCAAAGGTATTATGTACCTTGATGAAGTTATTAAGAAGAAACAGGGAAAGAAATCCAAATGA

Network for GWHGAAZE008759

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00347.24	Ribosomal_L6	13	88	1.10E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02933	RP-L6, MRPL6, rplF	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome
GO:0019843	molecular_function	rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	37.410
	SRR3591706	second leaf	18.087
	SRR3591707	mature leaf	19.207
	SRR3591708	Shoot apex	37.097
	SRR3591709	Stem	29.106
	SRR3591710	White floral bud	21.285
	SRR3591711	White flower	24.341
	SRR3591712	Green floral bud	38.237
	SRR3591713	Yellow flower	16.203
SRP173429	SRR8316895	Juvenile bud stage	24.269
	SRR8316896	Juvenile bud stage	38.028
	SRR8316897	Juvenile bud stage	16.374
	SRR8316894	Third green stage	14.448
	SRR8316900	Third green stage	43.593
	SRR8316901	Third green stage	41.577
	SRR8316898	Complete white stage	14.549
	SRR8316899	Complete white stage	42.190
	SRR8316903	Complete white stage	23.947
	SRR8316902	Silver flowering stage	10.827
	SRR8316904	Silver flowering stage	11.492
	SRR8316905	Silver flowering stage	7.694
	SRR8316906	Gold flowering stage	22.241
	SRR8316907	Gold flowering stage	23.410
	SRR8316908	Gold flowering stage	29.444
SRP132670	SRR6706286	Control	23.890
	SRR6706287	Light intensity 50%	22.130
	SRR6706288	Light intensity 20%	28.266
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	47.305
	CNS0095593	Slightly white alabastrum(diploid) 2	47.744
	CNS0095594	Slightly white alabastrum(diploid) 3	53.058
	CNS0095595	Whole white alabastrum(diploid) 2	33.760
	CNS0095596	Whole white alabastrum(diploid) 3	41.217
	CNS0095597	Whole white alabastrum(diploid) 4	43.468
	CNS0095598	Silvery flower (diploied) 1	32.886
	CNS0095599	Silvery flower (diploied) 2	34.115
	CNS0095600	Silvery flower (diploied) 3	28.722
	CNS0095601	Golden flower (diploid) 1	25.845
	CNS0095602	Golden flower (diploid) 2	25.998
	CNS0095603	Golden flower (diploid) 3	27.547
	CNS0095604	Slightly white alabastrum(tetraploid) 1	47.243
	CNS0095605	Slightly white alabastrum(tetraploid) 2	45.437
	CNS0095606	Slightly white alabastrum(tetraploid) 3	45.739
	CNS0095607	Whole white alabastrum(tetraploid) 1	21.301
	CNS0095608	Whole white alabastrum(tetraploid) 2	28.692
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.911
	CNS0095610	Silvery flower (tetraploid) 1	22.817
	CNS0095611	Silvery flower (tetraploid) 2	31.178
	CNS0095612	Silvery flower (tetraploid) 3	24.165
	CNS0095613	Golden flower (tetraploid) 1	16.938
	CNS0095614	Golden flower (tetraploid) 2	20.384
	CNS0095615	Golden flower (tetraploid) 3	18.541
CRA001975	CRR073297	Stem 1	27.114
	CRR073298	Stem 2	28.739
	CRR073299	Stem 3	32.427
	CRR073300	Leaf 1	31.920
	CRR073301	Leaf 2	29.282
	CRR073302	Leaf 3	29.050
	CRR073303	Juvenile bud 1	31.021
	CRR073304	Juvenile bud 2	25.998
	CRR073305	Juvenile bud 3	26.471
	CRR073306	Third green 1	14.846
	CRR073307	Third green 2	11.826
	CRR073308	Third green 3	13.872
	CRR073309	Second white 1	7.300
	CRR073310	Second white 2	12.222
	CRR073311	Second white 3	11.004
	CRR073312	Silver flowering 1	8.341
	CRR073313	Silver flowering 2	10.247
	CRR073314	Silver flowering 3	5.129
	CRR073315	Gold flowering 1	17.314
	CRR073316	Gold flowering 2	20.299
	CRR073317	Gold flowering 3	21.188
	CRR073318	Tawny withering 1	28.209
	CRR073319	Tawny withering 2	26.813
	CRR073320	Tawny withering 3	31.429