Gene detail

Detail information of GWHGAAZE008815

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006465785.1	3.89085E-57	PREDICTED: GPI mannosyltransferase 1-like isoform X3 [Citrus sinensis]
Swissprot	tr\|Q500W7\|PIGM_ARATH	9E-54	GPI mannosyltransferase 1
trEMBL	tr\|V4T2R4\|V4T2R4_9ROSI	3E-57	Uncharacterized protein {ECO:0000313\|EMBL:ESR45640.1}
TAIR10	AT5G22130.1	2E-45	mannosyltransferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	93337888	93342415	-
GWHAAZE00000002	mRNA	93337888	93342415	-
GWHAAZE00000002	exon	93342248	93342415	-
GWHAAZE00000002	exon	93337888	93338178	-
GWHAAZE00000002	CDS	93342248	93342415	-
GWHAAZE00000002	CDS	93338011	93338178	-
GWHAAZE00000002	three_prime_UTR	93337888	93338010	-

Transcript Sequence
>GWHTAAZE008825 TATTTTTATCACACATATCTCCACTATGAGCGTGAGTTTTCGGTTGCAGAAAAGCTGGTCTCTTTTCTGCCTCAAATTATAGTGCAGCTGGTCCTCATTTTCCGGTTTGGACGTGATTTGCCACTCTGCTGGTTCTTGCAGACAGTGGCGTTTGTCTCATTGAATAAGGTCATAACAGCACAGTATTTTGTGTGGTTTGTCTGCCTTCTACCCCTGATACTGCTGTGGAGCAGTATGAAGCTTAAATGGGAAGGCCTCACCTGCATATTATTGTGGATAGGAGCTCAATGTCACTGGCTAATGTGGGGATATCTCCTCGAATTCAAAGGTAAGTAAGTATTTATGCAGCTTTGGATGGCAGGTATTTTGTTCTTAGCTATTAATACCTATGTTCTTATCAGTATTATATGCTGCCACACTTATTCTCCAATATTTGGATGGTTAGAGCATCGAAGTTCG

Network for GWHGAAZE008815

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0040

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05007.14	Mannosyl_trans	1	111	1.50E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05284	PIGM	Metabolic pathways	map01100
K05284	PIGM	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0016021	cellular_component	integral component of membrane
GO:0016758	molecular_function	transferase activity, transferring hexosyl groups

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.084
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.060
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.237
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	2.570
	SRR8316896	Juvenile bud stage	2.843
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	1.066
	SRR8316900	Third green stage	2.890
	SRR8316901	Third green stage	2.600
	SRR8316898	Complete white stage	2.030
	SRR8316899	Complete white stage	4.573
	SRR8316903	Complete white stage	2.802
	SRR8316902	Silver flowering stage	1.859
	SRR8316904	Silver flowering stage	4.250
	SRR8316905	Silver flowering stage	1.171
	SRR8316906	Gold flowering stage	3.555
	SRR8316907	Gold flowering stage	7.098
	SRR8316908	Gold flowering stage	0.999
SRP132670	SRR6706286	Control	0.851
	SRR6706287	Light intensity 50%	1.666
	SRR6706288	Light intensity 20%	1.600
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.883
	CNS0095593	Slightly white alabastrum(diploid) 2	3.886
	CNS0095594	Slightly white alabastrum(diploid) 3	2.811
	CNS0095595	Whole white alabastrum(diploid) 2	4.977
	CNS0095596	Whole white alabastrum(diploid) 3	1.889
	CNS0095597	Whole white alabastrum(diploid) 4	2.494
	CNS0095598	Silvery flower (diploied) 1	3.902
	CNS0095599	Silvery flower (diploied) 2	3.678
	CNS0095600	Silvery flower (diploied) 3	1.195
	CNS0095601	Golden flower (diploid) 1	2.660
	CNS0095602	Golden flower (diploid) 2	2.467
	CNS0095603	Golden flower (diploid) 3	1.434
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.039
	CRR073298	Stem 2	1.701
	CRR073299	Stem 3	0.367
	CRR073300	Leaf 1	2.022
	CRR073301	Leaf 2	1.286
	CRR073302	Leaf 3	0.358
	CRR073303	Juvenile bud 1	0.531
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.139
	CRR073306	Third green 1	0.260
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.488
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.143
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.611
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.134
	CRR073319	Tawny withering 2	1.050
	CRR073320	Tawny withering 3	1.139