Gene detail

Detail information of GWHGAAZE008851

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006362889.1	1.49652E-44	PREDICTED: DNA polymerase epsilon subunit 3-like [Solanum tuberosum]
Swissprot	tr\|Q8VYK4\|NFYB8_ARATH	6E-11	Nuclear transcription factor Y subunit B-8
trEMBL	tr\|M1CHV0\|M1CHV0_SOLTU	6E-45	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400067767}
TAIR10	AT2G27470.1	6E-29	nuclear factor Y, subunit B11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	94617919	94620319	+
GWHAAZE00000002	mRNA	94617919	94620319	+
GWHAAZE00000002	exon	94617919	94618103	+
GWHAAZE00000002	exon	94619007	94619125	+
GWHAAZE00000002	exon	94620288	94620319	+
GWHAAZE00000002	CDS	94617919	94618103	+
GWHAAZE00000002	CDS	94619007	94619125	+
GWHAAZE00000002	CDS	94620288	94620319	+

Transcript Sequence
>GWHTAAZE008861 ATGGCGGAGAAAGTGGTGGTGGAGGCGGAAGAATTGCCGAAGACAATCGTAAGGAGGATAGTCAAGGATAAGCTCTCTCAGATGTCGTCGGCTTCGAAGGAAGGCACCGATATTTCAGTTCTCCGTGAGGCTCTTCAGGCTTTCTCCGAGAGCTCTCGAATCTTCATTCACTATCTCTCCGCTACTGCAAATGACGTATGCAAGGAGAACAAGAGGCAAACAATCAACGCTGAAGATGTTTTTAAAGCACTTGAAGAAATCGAGTTTCCTGAGTTTGTTGAACCTCTTAGAGCTTATCTTGAAGGTGATGGCAGTGGAGGTGAGAGAGGAGGTTAG

Network for GWHGAAZE008851

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00808.24	CBFD_NFYB_HMF	11	84	2.20E-08

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NF-YB

KEGG pathway

KO	Enzyme	pathway	mapID
K02326	POLE3	DNA replication	map03030
		Base excision repair	map03410
		Nucleotide excision repair	map03420

Gene Ontology

GO term	Ontology	Name
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.207
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.224
	SRR3591711	White flower	0.102
	SRR3591712	Green floral bud	0.214
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	12.106
	SRR8316896	Juvenile bud stage	16.955
	SRR8316897	Juvenile bud stage	10.521
	SRR8316894	Third green stage	7.201
	SRR8316900	Third green stage	20.974
	SRR8316901	Third green stage	15.584
	SRR8316898	Complete white stage	11.006
	SRR8316899	Complete white stage	21.882
	SRR8316903	Complete white stage	14.198
	SRR8316902	Silver flowering stage	10.832
	SRR8316904	Silver flowering stage	13.778
	SRR8316905	Silver flowering stage	7.697
	SRR8316906	Gold flowering stage	25.868
	SRR8316907	Gold flowering stage	30.620
	SRR8316908	Gold flowering stage	43.326
SRP132670	SRR6706286	Control	21.640
	SRR6706287	Light intensity 50%	19.908
	SRR6706288	Light intensity 20%	20.610
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.667
	CNS0095593	Slightly white alabastrum(diploid) 2	12.612
	CNS0095594	Slightly white alabastrum(diploid) 3	14.358
	CNS0095595	Whole white alabastrum(diploid) 2	12.116
	CNS0095596	Whole white alabastrum(diploid) 3	12.016
	CNS0095597	Whole white alabastrum(diploid) 4	7.032
	CNS0095598	Silvery flower (diploied) 1	9.066
	CNS0095599	Silvery flower (diploied) 2	13.365
	CNS0095600	Silvery flower (diploied) 3	16.916
	CNS0095601	Golden flower (diploid) 1	8.661
	CNS0095602	Golden flower (diploid) 2	13.746
	CNS0095603	Golden flower (diploid) 3	12.333
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.262
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.261
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.862
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.055
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.346
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.368
	CNS0095610	Silvery flower (tetraploid) 1	21.218
	CNS0095611	Silvery flower (tetraploid) 2	20.733
	CNS0095612	Silvery flower (tetraploid) 3	22.578
	CNS0095613	Golden flower (tetraploid) 1	12.522
	CNS0095614	Golden flower (tetraploid) 2	16.075
	CNS0095615	Golden flower (tetraploid) 3	14.020
CRA001975	CRR073297	Stem 1	13.458
	CRR073298	Stem 2	13.771
	CRR073299	Stem 3	14.997
	CRR073300	Leaf 1	15.322
	CRR073301	Leaf 2	12.012
	CRR073302	Leaf 3	18.414
	CRR073303	Juvenile bud 1	18.242
	CRR073304	Juvenile bud 2	12.580
	CRR073305	Juvenile bud 3	15.279
	CRR073306	Third green 1	15.154
	CRR073307	Third green 2	15.989
	CRR073308	Third green 3	13.713
	CRR073309	Second white 1	10.196
	CRR073310	Second white 2	16.088
	CRR073311	Second white 3	15.989
	CRR073312	Silver flowering 1	12.099
	CRR073313	Silver flowering 2	10.983
	CRR073314	Silver flowering 3	15.025
	CRR073315	Gold flowering 1	9.279
	CRR073316	Gold flowering 2	6.348
	CRR073317	Gold flowering 3	3.231
	CRR073318	Tawny withering 1	16.908
	CRR073319	Tawny withering 2	14.160
	CRR073320	Tawny withering 3	14.245