Gene detail

Detail information of GWHGAAZE008915

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009789370.1	6.70068E-41	PREDICTED: vesicle-associated membrane protein 714 isoform X2 [Nicotiana sylvestris]
Swissprot	tr\|Q9FMR5\|VA714_ARATH	2E-38	Vesicle-associated membrane protein 714
trEMBL	tr\|A0A059DA33\|A0A059DA33_EUCGR	3E-41	Uncharacterized protein {ECO:0000313\|EMBL:KCW87354.1}
TAIR10	AT5G22360.1	4E-31	vesicle-associated membrane protein 714

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	96812989	96813213	+
GWHAAZE00000002	mRNA	96812989	96813213	+
GWHAAZE00000002	exon	96812989	96813213	+
GWHAAZE00000002	CDS	96812989	96813213	+

Transcript Sequence
>GWHTAAZE008925 ATGGCTATTCTGTATGCCTTGGTGGCGAGGGGAATTACGGTGCTGGCGGAGTTCAGCGCCGTGACGGGGAACACCGGCGCCGTGGCTCGGCGGATCCTGGAGAAGCTGCCGCCCGAGGCCGAGTCGAGGTTGTGTTTCTCGCAGGATCGGTACATATTTCATATACTCAGATCCGATGGTCTCTCCTTCCTCTGTATGGCCAATGATACCTTCGGAAGTTCGTAA

Network for GWHGAAZE008915

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13774.7	Longin	29	73	5.50E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08515	VAMP7	SNARE interactions in vesicular transport	map04130

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	41.566
	SRR3591706	second leaf	26.173
	SRR3591707	mature leaf	30.119
	SRR3591708	Shoot apex	39.452
	SRR3591709	Stem	55.274
	SRR3591710	White floral bud	47.102
	SRR3591711	White flower	48.817
	SRR3591712	Green floral bud	55.179
	SRR3591713	Yellow flower	39.853
SRP173429	SRR8316895	Juvenile bud stage	28.125
	SRR8316896	Juvenile bud stage	43.420
	SRR8316897	Juvenile bud stage	16.502
	SRR8316894	Third green stage	14.620
	SRR8316900	Third green stage	46.314
	SRR8316901	Third green stage	46.440
	SRR8316898	Complete white stage	39.803
	SRR8316899	Complete white stage	111.036
	SRR8316903	Complete white stage	39.288
	SRR8316902	Silver flowering stage	31.690
	SRR8316904	Silver flowering stage	33.707
	SRR8316905	Silver flowering stage	13.821
	SRR8316906	Gold flowering stage	58.506
	SRR8316907	Gold flowering stage	63.138
	SRR8316908	Gold flowering stage	49.218
SRP132670	SRR6706286	Control	55.803
	SRR6706287	Light intensity 50%	54.671
	SRR6706288	Light intensity 20%	57.671
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	35.257
	CNS0095593	Slightly white alabastrum(diploid) 2	30.265
	CNS0095594	Slightly white alabastrum(diploid) 3	23.206
	CNS0095595	Whole white alabastrum(diploid) 2	32.325
	CNS0095596	Whole white alabastrum(diploid) 3	28.005
	CNS0095597	Whole white alabastrum(diploid) 4	24.739
	CNS0095598	Silvery flower (diploied) 1	28.347
	CNS0095599	Silvery flower (diploied) 2	34.419
	CNS0095600	Silvery flower (diploied) 3	64.530
	CNS0095601	Golden flower (diploid) 1	28.020
	CNS0095602	Golden flower (diploid) 2	76.240
	CNS0095603	Golden flower (diploid) 3	78.474
	CNS0095604	Slightly white alabastrum(tetraploid) 1	43.768
	CNS0095605	Slightly white alabastrum(tetraploid) 2	35.367
	CNS0095606	Slightly white alabastrum(tetraploid) 3	57.892
	CNS0095607	Whole white alabastrum(tetraploid) 1	30.906
	CNS0095608	Whole white alabastrum(tetraploid) 2	28.278
	CNS0095609	Whole white alabastrum(tetraploid) 3	48.170
	CNS0095610	Silvery flower (tetraploid) 1	55.430
	CNS0095611	Silvery flower (tetraploid) 2	59.479
	CNS0095612	Silvery flower (tetraploid) 3	60.701
	CNS0095613	Golden flower (tetraploid) 1	33.092
	CNS0095614	Golden flower (tetraploid) 2	54.005
	CNS0095615	Golden flower (tetraploid) 3	78.829
CRA001975	CRR073297	Stem 1	54.309
	CRR073298	Stem 2	59.290
	CRR073299	Stem 3	50.713
	CRR073300	Leaf 1	61.575
	CRR073301	Leaf 2	58.598
	CRR073302	Leaf 3	61.355
	CRR073303	Juvenile bud 1	74.091
	CRR073304	Juvenile bud 2	67.801
	CRR073305	Juvenile bud 3	59.996
	CRR073306	Third green 1	58.062
	CRR073307	Third green 2	67.365
	CRR073308	Third green 3	49.122
	CRR073309	Second white 1	49.204
	CRR073310	Second white 2	59.072
	CRR073311	Second white 3	37.369
	CRR073312	Silver flowering 1	37.637
	CRR073313	Silver flowering 2	27.825
	CRR073314	Silver flowering 3	26.411
	CRR073315	Gold flowering 1	48.952
	CRR073316	Gold flowering 2	55.182
	CRR073317	Gold flowering 3	40.892
	CRR073318	Tawny withering 1	65.812
	CRR073319	Tawny withering 2	43.377
	CRR073320	Tawny withering 3	61.714