Gene detail

Detail information of GWHGAAZE008916

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008391139.1	3.69449E-68	PREDICTED: vesicle-associated membrane protein 714 [Malus domestica]
Swissprot	tr\|Q9FMR5\|VA714_ARATH	2E-63	Vesicle-associated membrane protein 714
trEMBL	tr\|M5W028\|M5W028_PRUPE	5E-68	Uncharacterized protein {ECO:0000313\|EMBL:EMJ07064.1}
TAIR10	AT5G22360.1	6E-51	vesicle-associated membrane protein 714

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	96816821	96818535	+
GWHAAZE00000002	mRNA	96816821	96818535	+
GWHAAZE00000002	exon	96816821	96816967	+
GWHAAZE00000002	exon	96818368	96818535	+
GWHAAZE00000002	CDS	96816821	96816967	+
GWHAAZE00000002	CDS	96818368	96818535	+

Transcript Sequence
>GWHTAAZE008926 ATGAGGTTCATGAAAAACTATGGTAGAGTGGCACCTTATGCACCTGCTTATGCTATGAATGATGAATTTTCAAGGGTTTTGCATCAGCAGATGGAATTTTTCTCCAGTAACCCCAGTGCAGATACACTCAACCGTGTTAGAAGCGAAATACGCACCATCATGGTTGATAACATTGAGAAGATACTAGATAGGGGTGATCGGATTGAGCTTCTTGTTGATAAAACGGCAACAATGCAAGATAGCGCATTTCATTTTAAGAAACAGTCCAAGCGCCTTCGTCGAGCTCTATGGATGAAAAATGCCAAGCTCCTGTAA

Network for GWHGAAZE008916

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00957.22	Synaptobrevin	43	103	6.10E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08515	VAMP7	SNARE interactions in vesicular transport	map04130

Gene Ontology

GO term	Ontology	Name
GO:0016192	biological_process	vesicle-mediated transport
GO:0016021	cellular_component	integral component of membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	52.463
	SRR3591706	second leaf	30.699
	SRR3591707	mature leaf	38.770
	SRR3591708	Shoot apex	43.177
	SRR3591709	Stem	66.024
	SRR3591710	White floral bud	59.553
	SRR3591711	White flower	61.099
	SRR3591712	Green floral bud	64.279
	SRR3591713	Yellow flower	60.315
SRP173429	SRR8316895	Juvenile bud stage	35.629
	SRR8316896	Juvenile bud stage	51.489
	SRR8316897	Juvenile bud stage	27.917
	SRR8316894	Third green stage	19.406
	SRR8316900	Third green stage	60.010
	SRR8316901	Third green stage	54.017
	SRR8316898	Complete white stage	38.352
	SRR8316899	Complete white stage	120.787
	SRR8316903	Complete white stage	52.539
	SRR8316902	Silver flowering stage	36.353
	SRR8316904	Silver flowering stage	45.434
	SRR8316905	Silver flowering stage	17.007
	SRR8316906	Gold flowering stage	58.214
	SRR8316907	Gold flowering stage	63.364
	SRR8316908	Gold flowering stage	57.850
SRP132670	SRR6706286	Control	25.259
	SRR6706287	Light intensity 50%	27.398
	SRR6706288	Light intensity 20%	30.230
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	50.994
	CNS0095593	Slightly white alabastrum(diploid) 2	43.308
	CNS0095594	Slightly white alabastrum(diploid) 3	48.780
	CNS0095595	Whole white alabastrum(diploid) 2	50.449
	CNS0095596	Whole white alabastrum(diploid) 3	44.001
	CNS0095597	Whole white alabastrum(diploid) 4	40.537
	CNS0095598	Silvery flower (diploied) 1	35.948
	CNS0095599	Silvery flower (diploied) 2	51.841
	CNS0095600	Silvery flower (diploied) 3	68.526
	CNS0095601	Golden flower (diploid) 1	52.121
	CNS0095602	Golden flower (diploid) 2	71.135
	CNS0095603	Golden flower (diploid) 3	71.882
	CNS0095604	Slightly white alabastrum(tetraploid) 1	59.476
	CNS0095605	Slightly white alabastrum(tetraploid) 2	52.987
	CNS0095606	Slightly white alabastrum(tetraploid) 3	65.456
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.296
	CNS0095608	Whole white alabastrum(tetraploid) 2	44.389
	CNS0095609	Whole white alabastrum(tetraploid) 3	50.162
	CNS0095610	Silvery flower (tetraploid) 1	62.203
	CNS0095611	Silvery flower (tetraploid) 2	61.987
	CNS0095612	Silvery flower (tetraploid) 3	68.043
	CNS0095613	Golden flower (tetraploid) 1	47.110
	CNS0095614	Golden flower (tetraploid) 2	56.127
	CNS0095615	Golden flower (tetraploid) 3	67.774
CRA001975	CRR073297	Stem 1	39.156
	CRR073298	Stem 2	40.999
	CRR073299	Stem 3	40.847
	CRR073300	Leaf 1	45.893
	CRR073301	Leaf 2	44.851
	CRR073302	Leaf 3	63.781
	CRR073303	Juvenile bud 1	67.037
	CRR073304	Juvenile bud 2	51.152
	CRR073305	Juvenile bud 3	45.425
	CRR073306	Third green 1	30.418
	CRR073307	Third green 2	42.143
	CRR073308	Third green 3	35.559
	CRR073309	Second white 1	63.852
	CRR073310	Second white 2	54.140
	CRR073311	Second white 3	30.401
	CRR073312	Silver flowering 1	38.849
	CRR073313	Silver flowering 2	46.325
	CRR073314	Silver flowering 3	24.282
	CRR073315	Gold flowering 1	49.680
	CRR073316	Gold flowering 2	54.365
	CRR073317	Gold flowering 3	42.909
	CRR073318	Tawny withering 1	61.970
	CRR073319	Tawny withering 2	55.299
	CRR073320	Tawny withering 3	56.818