Gene detail

Detail information of GWHGAAZE008932

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002273038.1	1.47847E-56	PREDICTED: F-box protein At2g27310 [Vitis vinifera]
Swissprot	tr\|Q9SIH5\|FB322_ARATH	1E-46	Probable F-box protein At1g60180
trEMBL	tr\|F6HHD6\|F6HHD6_VITVI	6E-57	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB51632.1}
TAIR10	AT2G36090.1	1E-39	F-box family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	97055864	97056535	+
GWHAAZE00000002	mRNA	97055864	97056535	+
GWHAAZE00000002	exon	97055864	97056077	+
GWHAAZE00000002	exon	97056117	97056535	+
GWHAAZE00000002	CDS	97055864	97056077	+
GWHAAZE00000002	CDS	97056117	97056535	+

Transcript Sequence
>GWHTAAZE008942 ATGTCGTCTTCTTCTTTGTCTATCTCCAATATCGCTCACGGCGGTGCCACTCCAATCACCACCGTCCCACACAGCATCATTGAGGCCCACGTCTTAACCAGACTCGATGGTCCCAGTCTCGCCTCCGCCGCATCAACATCGCGTACAATGCACGCACTCTGCACCGATGAAAAACTATGGAGGGACATATGTACCTCCACTTGGACCTCCATCACCGGGTACCGGTCATTCTTCTCCGACTCCTTCCCCTCTACCATCCATTGCCCTAACACCTTGCTGCTAGATTATCACCGTCCTTGGCTTACGACTGAACTAATCTCAGCTGTCGATTTACACTACGAGAACAAGCTGATTTTTTCAAAAGTTGAAGTGACGGATACGGTTACTAAGAACTTCACGGGTCCATCGATGTGGATCGAACTATTTGATCGGAAAGAGACCGCCCCTGTTCCATTAAAGTTTGACAGTTTTAACGACGACTTTCTCTCACATCTACAAGAATCCATGAAATTGAGCTGGATCATGATTGACCCGACCCATAAACGATCACTGAATTTATCGAGCTTGACGCCTGTTTCCGTGCAACGACACTATATTGTAGATGAAGTGCAGCTTGTTTACGTGACGGTCCTA

Network for GWHGAAZE008932

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00646.34	F-box	30	64	0.00032

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	23.549
	SRR3591711	White flower	68.508
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	84.364
SRP173429	SRR8316895	Juvenile bud stage	0.114
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.062
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	14.087
	SRR8316899	Complete white stage	0.074
	SRR8316903	Complete white stage	17.490
	SRR8316902	Silver flowering stage	174.770
	SRR8316904	Silver flowering stage	248.742
	SRR8316905	Silver flowering stage	157.064
	SRR8316906	Gold flowering stage	384.441
	SRR8316907	Gold flowering stage	370.283
	SRR8316908	Gold flowering stage	375.966
SRP132670	SRR6706286	Control	0.436
	SRR6706287	Light intensity 50%	0.189
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.402
	CNS0095594	Slightly white alabastrum(diploid) 3	0.262
	CNS0095595	Whole white alabastrum(diploid) 2	0.837
	CNS0095596	Whole white alabastrum(diploid) 3	0.296
	CNS0095597	Whole white alabastrum(diploid) 4	0.769
	CNS0095598	Silvery flower (diploied) 1	45.969
	CNS0095599	Silvery flower (diploied) 2	44.350
	CNS0095600	Silvery flower (diploied) 3	245.884
	CNS0095601	Golden flower (diploid) 1	39.548
	CNS0095602	Golden flower (diploid) 2	150.522
	CNS0095603	Golden flower (diploid) 3	146.949
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.418
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.370
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.766
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.553
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.381
	CNS0095610	Silvery flower (tetraploid) 1	370.584
	CNS0095611	Silvery flower (tetraploid) 2	511.348
	CNS0095612	Silvery flower (tetraploid) 3	1419.126
	CNS0095613	Golden flower (tetraploid) 1	670.865
	CNS0095614	Golden flower (tetraploid) 2	379.316
	CNS0095615	Golden flower (tetraploid) 3	1031.723
CRA001975	CRR073297	Stem 1	1.351
	CRR073298	Stem 2	0.829
	CRR073299	Stem 3	0.627
	CRR073300	Leaf 1	1.080
	CRR073301	Leaf 2	0.463
	CRR073302	Leaf 3	1.016
	CRR073303	Juvenile bud 1	2.239
	CRR073304	Juvenile bud 2	0.660
	CRR073305	Juvenile bud 3	1.008
	CRR073306	Third green 1	925.713
	CRR073307	Third green 2	660.152
	CRR073308	Third green 3	667.928
	CRR073309	Second white 1	876.942
	CRR073310	Second white 2	873.902
	CRR073311	Second white 3	784.668
	CRR073312	Silver flowering 1	607.841
	CRR073313	Silver flowering 2	522.561
	CRR073314	Silver flowering 3	525.682
	CRR073315	Gold flowering 1	0.152
	CRR073316	Gold flowering 2	0.041
	CRR073317	Gold flowering 3	0.101
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.074
	CRR073320	Tawny withering 3	0.257