Gene detail

Detail information of GWHGAAZE008937

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003538102.1	1.0671E-166	PREDICTED: bifunctional nitrilase/nitrile hydratase NIT4A-like [Glycine max]
Swissprot	tr\|Q3LRV4\|NRL4B_LUPAN	4E-165	Bifunctional nitrilase/nitrile hydratase NIT4B
trEMBL	tr\|I1LKN7\|I1LKN7_SOYBN	1E-166	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA11G18620.1}
TAIR10	AT5G22300.1	5E-119	nitrilase 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	97158840	97164375	-
GWHAAZE00000002	mRNA	97158840	97164375	-
GWHAAZE00000002	exon	97164069	97164375	-
GWHAAZE00000002	exon	97160372	97160653	-
GWHAAZE00000002	exon	97158840	97158991	-
GWHAAZE00000002	CDS	97164069	97164375	-
GWHAAZE00000002	CDS	97160372	97160653	-
GWHAAZE00000002	CDS	97158840	97158991	-

Transcript Sequence
>GWHTAAZE008947 ATGATAAATGCAGGTCCCGAGGTTGACCGTTTGGCAGCAATGGCTGGAAAATATAAGGTACATCTAGTGATGGGGGTGATAGAAAGAGATGGATATACGCTCTATTGCACGGTTCTGTATTTCGACTCTCAAGGTCATTACCTTGGCAAGCACCGTAAAATCATGCCGACGGCATTGGAGCGCATAATTTGGGGCTTTGGAGATGGATCAACAATCCCAGTTTTCGATACTCCAATTGGAAAAATAGGTGCAGCTATATGCTGGGAAAACAGAATGCCACTTCTAAGGACTGCAATGTATGCTAAAGGCATTGAGATATATTGTGCACCTACAGCCGATGCCAGGGATTTGTGGCAAGCATCAATGACTCACATTGCTCTAGAGGGCGGATGCTTTGTTTTATCGGCTAATCAGTTCTGTCGGAGAAAAGATTATCCGCCTCCTCCAGAGTACGTATTTTCTGGCACTGAAGAAGACCTCACACCCGATTCTGTTGTTTGTGCTGGTGGCAGTGTCATCATTTCTCCGGCAGGGGTAGTTCTTGCGGGTCCCAATTATGAAGGAGAGGCACTCATCTCGGCTGACCTAGATATGGGGGAGATAGCACGGGCAAAGTTTGACTTTGATGTCGTTGGGCATTATTCAAGGCCTGAAGTGCTTAGTCTGGTGGTGAAGGACCATCCGACAATCCCGGTCACTTTCACATCTGCATCTGCAAACATTGATGGTTCTAAAAACTAG

Network for GWHGAAZE008937

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00795.23	CN_hydrolase	5	205	1.00E-51

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13035	NIT4	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Cyanoamino acid metabolism	map00460

Gene Ontology

GO term	Ontology	Name
GO:0006807	biological_process	nitrogen compound metabolic process
GO:0016810	molecular_function	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.371
	SRR3591706	second leaf	13.276
	SRR3591707	mature leaf	20.864
	SRR3591708	Shoot apex	19.734
	SRR3591709	Stem	13.850
	SRR3591710	White floral bud	20.374
	SRR3591711	White flower	21.169
	SRR3591712	Green floral bud	27.793
	SRR3591713	Yellow flower	16.310
SRP173429	SRR8316895	Juvenile bud stage	20.741
	SRR8316896	Juvenile bud stage	23.630
	SRR8316897	Juvenile bud stage	13.041
	SRR8316894	Third green stage	8.405
	SRR8316900	Third green stage	38.472
	SRR8316901	Third green stage	33.822
	SRR8316898	Complete white stage	8.951
	SRR8316899	Complete white stage	45.182
	SRR8316903	Complete white stage	13.247
	SRR8316902	Silver flowering stage	7.108
	SRR8316904	Silver flowering stage	6.820
	SRR8316905	Silver flowering stage	2.850
	SRR8316906	Gold flowering stage	19.304
	SRR8316907	Gold flowering stage	13.230
	SRR8316908	Gold flowering stage	22.705
SRP132670	SRR6706286	Control	30.881
	SRR6706287	Light intensity 50%	28.585
	SRR6706288	Light intensity 20%	31.836
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	32.088
	CNS0095593	Slightly white alabastrum(diploid) 2	26.327
	CNS0095594	Slightly white alabastrum(diploid) 3	22.441
	CNS0095595	Whole white alabastrum(diploid) 2	26.532
	CNS0095596	Whole white alabastrum(diploid) 3	22.496
	CNS0095597	Whole white alabastrum(diploid) 4	22.660
	CNS0095598	Silvery flower (diploied) 1	43.686
	CNS0095599	Silvery flower (diploied) 2	44.769
	CNS0095600	Silvery flower (diploied) 3	28.926
	CNS0095601	Golden flower (diploid) 1	36.176
	CNS0095602	Golden flower (diploid) 2	44.807
	CNS0095603	Golden flower (diploid) 3	37.314
	CNS0095604	Slightly white alabastrum(tetraploid) 1	31.686
	CNS0095605	Slightly white alabastrum(tetraploid) 2	27.685
	CNS0095606	Slightly white alabastrum(tetraploid) 3	49.017
	CNS0095607	Whole white alabastrum(tetraploid) 1	18.639
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.774
	CNS0095609	Whole white alabastrum(tetraploid) 3	34.872
	CNS0095610	Silvery flower (tetraploid) 1	27.957
	CNS0095611	Silvery flower (tetraploid) 2	36.476
	CNS0095612	Silvery flower (tetraploid) 3	22.216
	CNS0095613	Golden flower (tetraploid) 1	20.994
	CNS0095614	Golden flower (tetraploid) 2	24.589
	CNS0095615	Golden flower (tetraploid) 3	10.125
CRA001975	CRR073297	Stem 1	34.455
	CRR073298	Stem 2	30.260
	CRR073299	Stem 3	37.128
	CRR073300	Leaf 1	28.307
	CRR073301	Leaf 2	28.354
	CRR073302	Leaf 3	30.135
	CRR073303	Juvenile bud 1	38.475
	CRR073304	Juvenile bud 2	29.759
	CRR073305	Juvenile bud 3	29.608
	CRR073306	Third green 1	2.162
	CRR073307	Third green 2	2.206
	CRR073308	Third green 3	2.154
	CRR073309	Second white 1	10.635
	CRR073310	Second white 2	8.823
	CRR073311	Second white 3	6.354
	CRR073312	Silver flowering 1	5.359
	CRR073313	Silver flowering 2	10.599
	CRR073314	Silver flowering 3	8.464
	CRR073315	Gold flowering 1	60.376
	CRR073316	Gold flowering 2	62.793
	CRR073317	Gold flowering 3	57.710
	CRR073318	Tawny withering 1	21.941
	CRR073319	Tawny withering 2	17.027
	CRR073320	Tawny withering 3	16.451