Gene detail

Detail information of GWHGAAZE008938

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002272837.1	3.82556E-59	PREDICTED: bifunctional nitrilase/nitrile hydratase NIT4B [Vitis vinifera]
Swissprot	tr\|Q42966\|NRL4B_TOBAC	1E-60	Bifunctional nitrilase/nitrile hydratase NIT4B
trEMBL	tr\|F6HHD4\|F6HHD4_VITVI	1E-59	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB51630.1}
TAIR10	AT5G22300.1	6E-40	nitrilase 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	97166557	97170456	-
GWHAAZE00000002	mRNA	97166557	97170456	-
GWHAAZE00000002	exon	97170315	97170456	-
GWHAAZE00000002	exon	97166557	97166777	-
GWHAAZE00000002	CDS	97170315	97170456	-
GWHAAZE00000002	CDS	97166557	97166777	-

Transcript Sequence
>GWHTAAZE008948 ATGGCGCTGGTACCAACTCCAGTAAACGGCGGCGAACCAGTGTTCGCAGAGGTGGACATGGGGGCGGACTCTTCGGCCCCTACAGTCCGAGCCACCGTCGTCCAAGCCTCCACCATCTTTTACGACACTCCCGCCACTCTGGATAAAGCCGAGAGATTACTTGCTGAGGCAGCCTCATATGGATCCCAACTGGTTGTGTTTCCAGAAGCATTTGTGGGTGGTTATCCGCGTGGGTCTAACTTTGGAGTTAGTATTGGAAATCGTACGGCCAAGGGTAGAGAGGAGTTCCGAAAGTATCATGCTGCAGCAATTGATGTACCTGGTAATCCCCTTTTTGGTGTCTGTTTTAGGCAAATTGATTGA

Network for GWHGAAZE008938

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00795.23	CN_hydrolase	30	109	3.00E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13035	NIT4	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Cyanoamino acid metabolism	map00460

Gene Ontology

GO term	Ontology	Name
GO:0006807	biological_process	nitrogen compound metabolic process
GO:0016810	molecular_function	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.783
	SRR3591706	second leaf	8.568
	SRR3591707	mature leaf	10.178
	SRR3591708	Shoot apex	10.962
	SRR3591709	Stem	10.269
	SRR3591710	White floral bud	14.225
	SRR3591711	White flower	14.305
	SRR3591712	Green floral bud	17.683
	SRR3591713	Yellow flower	10.830
SRP173429	SRR8316895	Juvenile bud stage	12.312
	SRR8316896	Juvenile bud stage	14.874
	SRR8316897	Juvenile bud stage	7.061
	SRR8316894	Third green stage	6.332
	SRR8316900	Third green stage	24.489
	SRR8316901	Third green stage	19.531
	SRR8316898	Complete white stage	9.655
	SRR8316899	Complete white stage	28.109
	SRR8316903	Complete white stage	8.501
	SRR8316902	Silver flowering stage	4.054
	SRR8316904	Silver flowering stage	4.051
	SRR8316905	Silver flowering stage	2.315
	SRR8316906	Gold flowering stage	10.486
	SRR8316907	Gold flowering stage	9.614
	SRR8316908	Gold flowering stage	14.056
SRP132670	SRR6706286	Control	28.949
	SRR6706287	Light intensity 50%	27.505
	SRR6706288	Light intensity 20%	28.587
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.671
	CNS0095593	Slightly white alabastrum(diploid) 2	13.320
	CNS0095594	Slightly white alabastrum(diploid) 3	13.662
	CNS0095595	Whole white alabastrum(diploid) 2	12.483
	CNS0095596	Whole white alabastrum(diploid) 3	8.357
	CNS0095597	Whole white alabastrum(diploid) 4	11.581
	CNS0095598	Silvery flower (diploied) 1	27.547
	CNS0095599	Silvery flower (diploied) 2	25.951
	CNS0095600	Silvery flower (diploied) 3	21.234
	CNS0095601	Golden flower (diploid) 1	17.564
	CNS0095602	Golden flower (diploid) 2	31.776
	CNS0095603	Golden flower (diploid) 3	29.953
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.338
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.469
	CNS0095606	Slightly white alabastrum(tetraploid) 3	32.517
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.095
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.334
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.129
	CNS0095610	Silvery flower (tetraploid) 1	19.741
	CNS0095611	Silvery flower (tetraploid) 2	26.809
	CNS0095612	Silvery flower (tetraploid) 3	18.795
	CNS0095613	Golden flower (tetraploid) 1	11.236
	CNS0095614	Golden flower (tetraploid) 2	17.288
	CNS0095615	Golden flower (tetraploid) 3	10.377
CRA001975	CRR073297	Stem 1	26.901
	CRR073298	Stem 2	23.211
	CRR073299	Stem 3	34.354
	CRR073300	Leaf 1	23.299
	CRR073301	Leaf 2	22.452
	CRR073302	Leaf 3	28.933
	CRR073303	Juvenile bud 1	25.486
	CRR073304	Juvenile bud 2	24.721
	CRR073305	Juvenile bud 3	30.962
	CRR073306	Third green 1	1.592
	CRR073307	Third green 2	2.376
	CRR073308	Third green 3	3.411
	CRR073309	Second white 1	7.841
	CRR073310	Second white 2	10.255
	CRR073311	Second white 3	5.670
	CRR073312	Silver flowering 1	8.204
	CRR073313	Silver flowering 2	7.291
	CRR073314	Silver flowering 3	6.082
	CRR073315	Gold flowering 1	57.871
	CRR073316	Gold flowering 2	70.323
	CRR073317	Gold flowering 3	79.161
	CRR073318	Tawny withering 1	16.530
	CRR073319	Tawny withering 2	8.865
	CRR073320	Tawny withering 3	14.974