Gene detail

Detail information of GWHGAAZE009159

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI16255.3	1.31266E-57	unnamed protein product [Vitis vinifera]
Swissprot	tr\|Q84TE9\|DOF53_ARATH	3E-45	Dof zinc finger protein DOF5.3
trEMBL	tr\|F6GTX3\|F6GTX3_VITVI	8E-58	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB43637.1}
TAIR10	AT5G60200.1	2E-34	TARGET OF MONOPTEROS 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	103854735	103855118	-
GWHAAZE00000002	mRNA	103854735	103855118	-
GWHAAZE00000002	exon	103854735	103855118	-
GWHAAZE00000002	CDS	103854735	103855118	-

Transcript Sequence
>GWHTAAZE009169 ATGTTAGCATGCACAAAAGCACAACAAGAGAAGAAACCAAGGCCACCAGAGCAAGCACTGAAATGCCCAAGATGTGACTCCACCAACACCAAATTCTGCTACTACAACAACTACAGCCTCACCCAGCCTAGGTACTTCTGCAAGTCCTGCAGAAGGTACTGGACCAAAGGCGGAACCCTGAGGAATGTTCCAGTAGGTGGAGGGTGCAGGAAGAACAAAAGATCTTCGTCCTCCTCTTCGTCGTCCTCATCATCCTCCAAAAGAACCCAAGATAACCAGAACCCACTCATCACACCCATTCACACCCCAAGCTTCTCCCCCTTATCATATGACTCGACTGACCTTTCGCTCGCCTTTGCTCGCCTCCAGCATCAACCCGGAGGC

Network for GWHGAAZE009159

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02701.16	zf-Dof	18	74	2.20E-34

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-Dof

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	31.808
	SRR3591706	second leaf	14.441
	SRR3591707	mature leaf	1.944
	SRR3591708	Shoot apex	42.551
	SRR3591709	Stem	21.478
	SRR3591710	White floral bud	9.883
	SRR3591711	White flower	7.297
	SRR3591712	Green floral bud	18.315
	SRR3591713	Yellow flower	1.012
SRP173429	SRR8316895	Juvenile bud stage	19.623
	SRR8316896	Juvenile bud stage	16.032
	SRR8316897	Juvenile bud stage	7.127
	SRR8316894	Third green stage	4.766
	SRR8316900	Third green stage	7.744
	SRR8316901	Third green stage	9.115
	SRR8316898	Complete white stage	0.701
	SRR8316899	Complete white stage	10.211
	SRR8316903	Complete white stage	2.321
	SRR8316902	Silver flowering stage	0.183
	SRR8316904	Silver flowering stage	0.761
	SRR8316905	Silver flowering stage	0.252
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.232
	SRR8316908	Gold flowering stage	0.294
SRP132670	SRR6706286	Control	9.789
	SRR6706287	Light intensity 50%	8.170
	SRR6706288	Light intensity 20%	7.025
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.976
	CNS0095593	Slightly white alabastrum(diploid) 2	15.489
	CNS0095594	Slightly white alabastrum(diploid) 3	12.390
	CNS0095595	Whole white alabastrum(diploid) 2	4.152
	CNS0095596	Whole white alabastrum(diploid) 3	4.227
	CNS0095597	Whole white alabastrum(diploid) 4	3.024
	CNS0095598	Silvery flower (diploied) 1	4.512
	CNS0095599	Silvery flower (diploied) 2	3.619
	CNS0095600	Silvery flower (diploied) 3	1.234
	CNS0095601	Golden flower (diploid) 1	4.993
	CNS0095602	Golden flower (diploid) 2	3.929
	CNS0095603	Golden flower (diploid) 3	3.551
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.193
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.785
	CNS0095606	Slightly white alabastrum(tetraploid) 3	33.090
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.172
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.063
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.576
	CNS0095610	Silvery flower (tetraploid) 1	1.225
	CNS0095611	Silvery flower (tetraploid) 2	2.039
	CNS0095612	Silvery flower (tetraploid) 3	2.237
	CNS0095613	Golden flower (tetraploid) 1	0.530
	CNS0095614	Golden flower (tetraploid) 2	0.307
	CNS0095615	Golden flower (tetraploid) 3	1.171
CRA001975	CRR073297	Stem 1	46.812
	CRR073298	Stem 2	42.907
	CRR073299	Stem 3	92.647
	CRR073300	Leaf 1	17.496
	CRR073301	Leaf 2	22.696
	CRR073302	Leaf 3	28.238
	CRR073303	Juvenile bud 1	8.549
	CRR073304	Juvenile bud 2	7.965
	CRR073305	Juvenile bud 3	20.471
	CRR073306	Third green 1	3.531
	CRR073307	Third green 2	3.774
	CRR073308	Third green 3	3.291
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.314
	CRR073311	Second white 3	0.225
	CRR073312	Silver flowering 1	0.181
	CRR073313	Silver flowering 2	1.849
	CRR073314	Silver flowering 3	0.416
	CRR073315	Gold flowering 1	18.776
	CRR073316	Gold flowering 2	18.484
	CRR073317	Gold flowering 3	12.538
	CRR073318	Tawny withering 1	78.755
	CRR073319	Tawny withering 2	42.862
	CRR073320	Tawny withering 3	87.048