Gene detail

Detail information of GWHGAAZE009218

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010047429.1	3.85059E-96	PREDICTED: histone H2A [Eucalyptus grandis]
Swissprot	tr\|Q9M531\|H2A_EUPES	8E-82	Histone H2A
trEMBL	tr\|A0A059DFA5\|A0A059DFA5_EUCGR	1E-96	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT5G02560.1	5E-43	histone H2A 12

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	105693165	105694093	-
GWHAAZE00000002	mRNA	105693165	105694093	-
GWHAAZE00000002	exon	105693876	105694093	-
GWHAAZE00000002	exon	105693165	105693671	-
GWHAAZE00000002	five_prime_UTR	105694086	105694093	-
GWHAAZE00000002	CDS	105693876	105694085	-
GWHAAZE00000002	CDS	105693426	105693671	-
GWHAAZE00000002	three_prime_UTR	105693165	105693425	-

Transcript Sequence
>GWHTAAZE009228 TTAGATCAATGGAGACCGGTGGTAAACTGAAGAAAGGTGCCGGTGGAAGGAAGTTCGGCGGTCCGAAGAAGAAGCCTGTTTCACGTTCTGTTAAGGCCGGGCTTCAGTTTCCGGTCGGTCGAATTGGCCGCTACCTCAAAAAGGGACGATACTCTCAGCGCATTGGAACCGGTGCTCCGGTTTACTTGGCCGCCGTTCTTGAATACCTAGCTGCTGAGGTATTGGAATTGGCTGGAAATGCTGCAAGAGATAACAAGAAGAACAGAATAATACCAAGGCATGTTCTATTGGCAGTGAGGAATGATGAAGAACTTGGAAAGTTGCTAGCTGGGGTTACCATTGCACATGGTGGCGTTCTTCCAAATATTAACCCTATTCTTTTGCCCAAAAAGACTGATAAGGCTACTAAGGAACCTAAATCTCCTTCCAAGGCAACCAAGTCCCCCAAAAAGGCTGCTGCTTAGGATACCATTAATCACTTAGAAACTTATATAATCTTAGAGTGTTTTAATTTTTCTATTTTTGTATGTATTTGGTTTGTGATTTTTAGGGAAATTGGTAAGGGGCTGTGTTTTGCACTTCTTAATCTTACCATCACTATGTTAAGGCCATCTGTTGATCAATGAAAGAAATCACTTATTTCTTCAGTTAAAGTCTTACTTTGGACTGTAAGATTGTAAATGCATTGTTTTAAATTTTATTGCATTGGTTGTCTCTTTGTGATC

Network for GWHGAAZE009218

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00125.25	Histone	20	97	5.50E-13
PF16211.6	Histone_H2A_C	100	134	1.80E-18

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	187.283
	SRR3591706	second leaf	53.947
	SRR3591707	mature leaf	12.213
	SRR3591708	Shoot apex	742.852
	SRR3591709	Stem	78.022
	SRR3591710	White floral bud	20.883
	SRR3591711	White flower	8.538
	SRR3591712	Green floral bud	19.662
	SRR3591713	Yellow flower	1.004
SRP173429	SRR8316895	Juvenile bud stage	51.106
	SRR8316896	Juvenile bud stage	50.912
	SRR8316897	Juvenile bud stage	16.083
	SRR8316894	Third green stage	11.725
	SRR8316900	Third green stage	13.238
	SRR8316901	Third green stage	12.008
	SRR8316898	Complete white stage	5.356
	SRR8316899	Complete white stage	15.027
	SRR8316903	Complete white stage	10.299
	SRR8316902	Silver flowering stage	7.040
	SRR8316904	Silver flowering stage	7.016
	SRR8316905	Silver flowering stage	5.013
	SRR8316906	Gold flowering stage	17.017
	SRR8316907	Gold flowering stage	21.404
	SRR8316908	Gold flowering stage	16.520
SRP132670	SRR6706286	Control	21.481
	SRR6706287	Light intensity 50%	22.921
	SRR6706288	Light intensity 20%	30.236
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	61.586
	CNS0095593	Slightly white alabastrum(diploid) 2	54.163
	CNS0095594	Slightly white alabastrum(diploid) 3	39.531
	CNS0095595	Whole white alabastrum(diploid) 2	17.205
	CNS0095596	Whole white alabastrum(diploid) 3	7.780
	CNS0095597	Whole white alabastrum(diploid) 4	10.549
	CNS0095598	Silvery flower (diploied) 1	18.246
	CNS0095599	Silvery flower (diploied) 2	24.943
	CNS0095600	Silvery flower (diploied) 3	12.631
	CNS0095601	Golden flower (diploid) 1	12.791
	CNS0095602	Golden flower (diploid) 2	8.377
	CNS0095603	Golden flower (diploid) 3	11.144
	CNS0095604	Slightly white alabastrum(tetraploid) 1	60.361
	CNS0095605	Slightly white alabastrum(tetraploid) 2	50.005
	CNS0095606	Slightly white alabastrum(tetraploid) 3	93.933
	CNS0095607	Whole white alabastrum(tetraploid) 1	18.347
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.604
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.074
	CNS0095610	Silvery flower (tetraploid) 1	4.102
	CNS0095611	Silvery flower (tetraploid) 2	8.924
	CNS0095612	Silvery flower (tetraploid) 3	13.876
	CNS0095613	Golden flower (tetraploid) 1	6.176
	CNS0095614	Golden flower (tetraploid) 2	4.321
	CNS0095615	Golden flower (tetraploid) 3	10.307
CRA001975	CRR073297	Stem 1	71.857
	CRR073298	Stem 2	63.647
	CRR073299	Stem 3	124.683
	CRR073300	Leaf 1	10.857
	CRR073301	Leaf 2	8.922
	CRR073302	Leaf 3	14.454
	CRR073303	Juvenile bud 1	7.058
	CRR073304	Juvenile bud 2	4.464
	CRR073305	Juvenile bud 3	10.439
	CRR073306	Third green 1	15.480
	CRR073307	Third green 2	14.352
	CRR073308	Third green 3	13.333
	CRR073309	Second white 1	19.335
	CRR073310	Second white 2	12.666
	CRR073311	Second white 3	14.176
	CRR073312	Silver flowering 1	12.573
	CRR073313	Silver flowering 2	9.136
	CRR073314	Silver flowering 3	8.051
	CRR073315	Gold flowering 1	9.379
	CRR073316	Gold flowering 2	11.608
	CRR073317	Gold flowering 3	10.136
	CRR073318	Tawny withering 1	114.118
	CRR073319	Tawny withering 2	100.418
	CRR073320	Tawny withering 3	137.123