Gene detail

Detail information of GWHGAAZE009284

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002313412.1	1.21842E-53	copper transporter family protein [Populus trichocarpa]
Swissprot	tr\|Q39065\|COPT1_ARATH	9E-42	Copper transporter 1
trEMBL	tr\|B9HPB1\|B9HPB1_POPTR	5E-54	Copper transporter family protein {ECO:0000313\|EMBL:EEE87367.1}
TAIR10	AT5G59030.1	4E-33	copper transporter 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	107110029	107110523	+
GWHAAZE00000002	mRNA	107110029	107110523	+
GWHAAZE00000002	exon	107110029	107110523	+
GWHAAZE00000002	CDS	107110029	107110523	+

Transcript Sequence
>GWHTAAZE009294 ATGGAGAACATGCCCGGAGGTCACGTGCACAGCATGCCCCCACCCTCAATGTCCCCATCGGCACCCAACGGCACCGGCACGATGATGGGTCCCATGCACCGACACGGAATGATGATGCACATGACCTTCTACTGGGGCCCCGAGGCCGTGGTTCTCTTCACGGGTTGGCCCGGGACCCGACCCGGTATGTATGCGGTTTGCCTCGTTTTCGTCACGTTTCTTGCCGTTTTCGTCGAGTGGCTCTCTCACTGCAACCTCGTCACTGATGGGTCGAACCGGGTCGGGTCGGGTATTGTTAAGACCCTCATGCACATGCTCCGTATGGGTCTTGCTTATATGGTGATGCTTGCGGTTATGTCATTTAATGTGGGTGTGTTTTTGGCGGCGATTGTTGGACACGCGCTGGGATTCCTTTTGTTCGGGAGTGGGGTTTTCAAGACGTCTCCGGCGGTTCCATTCGGGAAGACTTCCGACCTACCGCCGATGAGTTGCTGA

Network for GWHGAAZE009284

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04145.16	Ctr	41	82	3.10E-07
PF04145.16	Ctr	97	140	2.40E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14686	SLC31A1, CTR1	Mineral absorption	map04978

Gene Ontology

GO term	Ontology	Name
GO:0035434	biological_process	copper ion transmembrane transport
GO:0016021	cellular_component	integral component of membrane
GO:0005375	molecular_function	copper ion transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.146
	SRR3591706	second leaf	18.129
	SRR3591707	mature leaf	29.514
	SRR3591708	Shoot apex	4.222
	SRR3591709	Stem	4.721
	SRR3591710	White floral bud	13.068
	SRR3591711	White flower	1.210
	SRR3591712	Green floral bud	31.736
	SRR3591713	Yellow flower	1.145
SRP173429	SRR8316895	Juvenile bud stage	2.118
	SRR8316896	Juvenile bud stage	10.735
	SRR8316897	Juvenile bud stage	11.318
	SRR8316894	Third green stage	4.545
	SRR8316900	Third green stage	24.144
	SRR8316901	Third green stage	33.739
	SRR8316898	Complete white stage	0.309
	SRR8316899	Complete white stage	3.002
	SRR8316903	Complete white stage	0.767
	SRR8316902	Silver flowering stage	0.148
	SRR8316904	Silver flowering stage	0.351
	SRR8316905	Silver flowering stage	0.038
	SRR8316906	Gold flowering stage	0.184
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.145
SRP132670	SRR6706286	Control	13.041
	SRR6706287	Light intensity 50%	10.860
	SRR6706288	Light intensity 20%	10.217
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	32.768
	CNS0095593	Slightly white alabastrum(diploid) 2	26.420
	CNS0095594	Slightly white alabastrum(diploid) 3	37.769
	CNS0095595	Whole white alabastrum(diploid) 2	32.760
	CNS0095596	Whole white alabastrum(diploid) 3	40.142
	CNS0095597	Whole white alabastrum(diploid) 4	38.348
	CNS0095598	Silvery flower (diploied) 1	1.400
	CNS0095599	Silvery flower (diploied) 2	0.723
	CNS0095600	Silvery flower (diploied) 3	0.437
	CNS0095601	Golden flower (diploid) 1	1.568
	CNS0095602	Golden flower (diploid) 2	0.409
	CNS0095603	Golden flower (diploid) 3	0.718
	CNS0095604	Slightly white alabastrum(tetraploid) 1	18.272
	CNS0095605	Slightly white alabastrum(tetraploid) 2	21.807
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.660
	CNS0095607	Whole white alabastrum(tetraploid) 1	29.492
	CNS0095608	Whole white alabastrum(tetraploid) 2	29.383
	CNS0095609	Whole white alabastrum(tetraploid) 3	12.387
	CNS0095610	Silvery flower (tetraploid) 1	0.155
	CNS0095611	Silvery flower (tetraploid) 2	0.611
	CNS0095612	Silvery flower (tetraploid) 3	1.523
	CNS0095613	Golden flower (tetraploid) 1	1.083
	CNS0095614	Golden flower (tetraploid) 2	0.843
	CNS0095615	Golden flower (tetraploid) 3	0.912
CRA001975	CRR073297	Stem 1	5.604
	CRR073298	Stem 2	9.535
	CRR073299	Stem 3	4.655
	CRR073300	Leaf 1	16.246
	CRR073301	Leaf 2	16.987
	CRR073302	Leaf 3	16.051
	CRR073303	Juvenile bud 1	6.311
	CRR073304	Juvenile bud 2	7.711
	CRR073305	Juvenile bud 3	0.892
	CRR073306	Third green 1	1.992
	CRR073307	Third green 2	3.523
	CRR073308	Third green 3	2.612
	CRR073309	Second white 1	0.920
	CRR073310	Second white 2	0.751
	CRR073311	Second white 3	1.435
	CRR073312	Silver flowering 1	2.450
	CRR073313	Silver flowering 2	2.080
	CRR073314	Silver flowering 3	1.507
	CRR073315	Gold flowering 1	3.534
	CRR073316	Gold flowering 2	0.703
	CRR073317	Gold flowering 3	0.346
	CRR073318	Tawny withering 1	0.967
	CRR073319	Tawny withering 2	6.348
	CRR073320	Tawny withering 3	0.946