Gene detail

Detail information of GWHGAAZE009307

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006350814.1	1.42382E-23	PREDICTED: cytosolic enolase 3-like [Solanum tuberosum]
Swissprot	tr\|Q9ZW34\|ENO3_ARATH	2E-20	Cytosolic enolase 3
trEMBL	tr\|M1CZ87\|M1CZ87_SOLTU	7E-25	Enolase {ECO:0000256\|RuleBase:RU000654}
TAIR10	AT2G29560.1	2E-17	cytosolic enolase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	107383631	107383780	+
GWHAAZE00000002	mRNA	107383631	107383780	+
GWHAAZE00000002	exon	107383631	107383780	+
GWHAAZE00000002	CDS	107383631	107383780	+

Transcript Sequence
>GWHTAAZE009317 ATGAGAAAATCGGTTCCTTCGGTCATCACAAAGGTTAAAGCAAGGCAAATCCTTGATAGCAGAGGAATTCCTACCGTTGAAGTTGATTTGCACACTAATAAAGGCACCTTCCGTGCTTCTGCTCCCAGTGGTGCTTCCTCCGGAATGTAA

Network for GWHGAAZE009307

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03952.17	Enolase_N	9	48	4.80E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01689	ENO, eno	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		Biosynthesis of amino acids	map01230
		Glycolysis / Gluconeogenesis	map00010
		Methane metabolism	map00680
		RNA degradation	map03018
		HIF-1 signaling pathway	map04066

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	32.741
	SRR3591706	second leaf	17.627
	SRR3591707	mature leaf	6.835
	SRR3591708	Shoot apex	22.991
	SRR3591709	Stem	16.766
	SRR3591710	White floral bud	28.146
	SRR3591711	White flower	32.932
	SRR3591712	Green floral bud	32.548
	SRR3591713	Yellow flower	20.665
SRP173429	SRR8316895	Juvenile bud stage	20.645
	SRR8316896	Juvenile bud stage	28.324
	SRR8316897	Juvenile bud stage	14.639
	SRR8316894	Third green stage	12.551
	SRR8316900	Third green stage	30.702
	SRR8316901	Third green stage	30.116
	SRR8316898	Complete white stage	8.011
	SRR8316899	Complete white stage	27.340
	SRR8316903	Complete white stage	14.442
	SRR8316902	Silver flowering stage	6.295
	SRR8316904	Silver flowering stage	12.050
	SRR8316905	Silver flowering stage	5.059
	SRR8316906	Gold flowering stage	17.795
	SRR8316907	Gold flowering stage	21.961
	SRR8316908	Gold flowering stage	17.514
SRP132670	SRR6706286	Control	30.324
	SRR6706287	Light intensity 50%	31.793
	SRR6706288	Light intensity 20%	34.160
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.358
	CNS0095593	Slightly white alabastrum(diploid) 2	8.298
	CNS0095594	Slightly white alabastrum(diploid) 3	11.514
	CNS0095595	Whole white alabastrum(diploid) 2	13.077
	CNS0095596	Whole white alabastrum(diploid) 3	9.041
	CNS0095597	Whole white alabastrum(diploid) 4	7.248
	CNS0095598	Silvery flower (diploied) 1	13.112
	CNS0095599	Silvery flower (diploied) 2	6.124
	CNS0095600	Silvery flower (diploied) 3	16.665
	CNS0095601	Golden flower (diploid) 1	8.233
	CNS0095602	Golden flower (diploid) 2	15.173
	CNS0095603	Golden flower (diploid) 3	18.307
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.847
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.547
	CNS0095606	Slightly white alabastrum(tetraploid) 3	29.515
	CNS0095607	Whole white alabastrum(tetraploid) 1	15.914
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.780
	CNS0095609	Whole white alabastrum(tetraploid) 3	29.991
	CNS0095610	Silvery flower (tetraploid) 1	13.634
	CNS0095611	Silvery flower (tetraploid) 2	20.778
	CNS0095612	Silvery flower (tetraploid) 3	18.634
	CNS0095613	Golden flower (tetraploid) 1	8.365
	CNS0095614	Golden flower (tetraploid) 2	13.283
	CNS0095615	Golden flower (tetraploid) 3	12.473
CRA001975	CRR073297	Stem 1	41.064
	CRR073298	Stem 2	33.436
	CRR073299	Stem 3	40.821
	CRR073300	Leaf 1	36.398
	CRR073301	Leaf 2	36.265
	CRR073302	Leaf 3	47.012
	CRR073303	Juvenile bud 1	38.488
	CRR073304	Juvenile bud 2	23.445
	CRR073305	Juvenile bud 3	36.267
	CRR073306	Third green 1	6.741
	CRR073307	Third green 2	5.862
	CRR073308	Third green 3	9.158
	CRR073309	Second white 1	8.308
	CRR073310	Second white 2	5.639
	CRR073311	Second white 3	8.542
	CRR073312	Silver flowering 1	6.789
	CRR073313	Silver flowering 2	2.447
	CRR073314	Silver flowering 3	5.161
	CRR073315	Gold flowering 1	13.490
	CRR073316	Gold flowering 2	25.412
	CRR073317	Gold flowering 3	13.451
	CRR073318	Tawny withering 1	22.613
	CRR073319	Tawny withering 2	14.653
	CRR073320	Tawny withering 3	21.287