Gene detail

Detail information of GWHGAAZE009384

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004296053.1	6.89332E-94	PREDICTED: LOB domain-containing protein 12-like [Fragaria vesca subsp. vesca]
Swissprot	tr\|Q8LBW3\|LBD12_ARATH	1E-78	LOB domain-containing protein 12
trEMBL	tr\|A0A068ULU3\|A0A068ULU3_COFCA	2E-93	Coffea canephora DH200=94 genomic scaffold, scaffold_36 {ECO:0000313\|EMBL:CDP09242.1}
TAIR10	AT2G30130.1	8E-63	Lateral organ boundaries (LOB) domain family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	109166151	109167426	+
GWHAAZE00000002	mRNA	109166151	109167426	+
GWHAAZE00000002	exon	109166151	109166306	+
GWHAAZE00000002	exon	109167067	109167426	+
GWHAAZE00000002	CDS	109166151	109166306	+
GWHAAZE00000002	CDS	109167067	109167426	+

Transcript Sequence
>GWHTAAZE009394 ATGGGTGGAAGCTCGCCATGTGCGTCTTGTAAGTTGTTGAGGAGAAGATGCGCAAAAGACTGTATTTTTGCGCCTTACTTTCCTCCTGATGATCCTCATAAGTTTGCCATTGTTCACAAGGTTTTCGGTGCTAGCAATGTCAGCAAGATGTTACAGGAGCTTCCAATTCACCAGAGAGGAGACGCAGTGAGCAGTCTAGTTTATGAAGCAAATGCGAGGATGAGAGACCCTGTGTATGGGTGCGTAGGGGCAATATCGTACTTACAAAACCAAGTTTCTCAGTTGGAGATGCAGCTCGCAGTTGCTCAAGCAGAGATCCTATGTATCCAGATGCAGCAAGAGCCAACCGCAGCCCTACCCAATATGCATATGGATGATATTGCTGATCAGAAATCACTTGTTTTATCGCCGAATCATCATAATTTCAATAATAGTCTCCCACAGTACCTCAGCTTTGGTAATTCTTCTAGCATTGTAATCCAGGACCCTCTTAACAGAGAGTCTCTTTGGACATAA

Network for GWHGAAZE009384

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03195.15	LOB	6	103	4.40E-42

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	LOB

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.206
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.265
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	1.476
	SRR3591711	White flower	0.907
	SRR3591712	Green floral bud	0.146
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.145
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.208
	SRR8316894	Third green stage	0.098
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.877
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.738
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.106
SRP132670	SRR6706286	Control	0.034
	SRR6706287	Light intensity 50%	0.156
	SRR6706288	Light intensity 20%	0.239
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.553
	CNS0095593	Slightly white alabastrum(diploid) 2	0.336
	CNS0095594	Slightly white alabastrum(diploid) 3	0.424
	CNS0095595	Whole white alabastrum(diploid) 2	0.452
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.268
	CNS0095598	Silvery flower (diploied) 1	1.717
	CNS0095599	Silvery flower (diploied) 2	1.480
	CNS0095600	Silvery flower (diploied) 3	0.322
	CNS0095601	Golden flower (diploid) 1	0.887
	CNS0095602	Golden flower (diploid) 2	1.380
	CNS0095603	Golden flower (diploid) 3	0.666
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.177
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.539
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.677
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.089
	CNS0095610	Silvery flower (tetraploid) 1	0.611
	CNS0095611	Silvery flower (tetraploid) 2	4.464
	CNS0095612	Silvery flower (tetraploid) 3	2.004
	CNS0095613	Golden flower (tetraploid) 1	0.274
	CNS0095614	Golden flower (tetraploid) 2	0.938
	CNS0095615	Golden flower (tetraploid) 3	0.199
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.154
	CRR073299	Stem 3	0.105
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.145
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.655
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.006
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.134
	CRR073320	Tawny withering 3	0.000