Gene detail

Detail information of GWHGAAZE009416

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002517727.1	1.0698E-149	Cationic peroxidase 1 precursor, putative [Ricinus communis]
Swissprot	tr\|P22195\|PER1_ARAHY	2E-135	Cationic peroxidase 1 (Precursor)
trEMBL	tr\|B9RVF8\|B9RVF8_RICCO	4E-150	Cationic peroxidase 1, putative {ECO:0000313\|EMBL:EEF44659.1}
TAIR10	AT5G05340.1	3E-94	Peroxidase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	109745257	109748416	+
GWHAAZE00000002	mRNA	109745257	109748416	+
GWHAAZE00000002	exon	109745257	109745298	+
GWHAAZE00000002	exon	109745739	109745930	+
GWHAAZE00000002	exon	109747717	109747882	+
GWHAAZE00000002	exon	109748031	109748416	+
GWHAAZE00000002	CDS	109745257	109745298	+
GWHAAZE00000002	CDS	109745739	109745930	+
GWHAAZE00000002	CDS	109747717	109747882	+
GWHAAZE00000002	CDS	109748031	109748416	+

Transcript Sequence
>GWHTAAZE009426 ATGGGCGCCTCCTTGCTCCGCCTTCATTTCCACGACTGCTTCGGTTGTGATGCATCTGTCCTATTAGACGACACATCGAGTTCTAAAGGGGAGAAGACGGCAAGTGCGAATGTAGATTCGTTAAGGGGTTTTGATGTGATTGATAACATTAAATCCGAAGTCGAGAAAATTTGTCCCGGTGTTGTTTCTTGTGCTGATATTCTTTCTGTTGCTGCTCGTGATTCTGCTGTTCTATTGGGTGGGCCTTCATGGGAAGTTGAATTAGGCAGAAGAGACTCCACCACGGCAAGCTTAAGCGCAGTAAACAGCAATCTCCCATCTTTCACCATGGATCTCGCTGATCTCATATCTACCTTTTCTAAAAAGGGCTTCACTCCCAAAGAAATGGTTGCTCTTTCTGGAGCTCACACAATTGGCCAAGCCAAGTGCATGACATTTCGAGGCCGAATCTACAACGAGACCACCATCGATTCATCAGTCGCCACATCTTTAAAGTCAAATTGTCCCAGCAACGGCGGTGACAACAATCTTTCTCCTCTAGACGCAACTAGCCCCGTTATTTTTGATAACGCGTATTACAAGAATTTAGTAAACAACAAGGGCCTCCTTCATTCTGATCACCAGCTCTTCAGCGGCGGTTCTACTGACTCTCAAGTCACTACTTATAGCAACGACCCACACACATTCTATGCAGATTTTGCTAGTGCCATGGTTAAAATGGCAAATCTTAGCCCACTCACCGGAACTAGTGGCCAGATTCGTACCAATTGCCGGAAAATCAACTAA

Network for GWHGAAZE009416

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00141.24	peroxidase	1	225	2.30E-72

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00430	E1.11.1.7	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Phenylpropanoid biosynthesis	map00940

Gene Ontology

GO term	Ontology	Name
GO:0042744	biological_process	hydrogen peroxide catabolic process
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.725
	SRR3591706	second leaf	3.374
	SRR3591707	mature leaf	0.113
	SRR3591708	Shoot apex	0.599
	SRR3591709	Stem	1.202
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.286
	SRR3591712	Green floral bud	0.095
	SRR3591713	Yellow flower	150.011
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.170
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.011
	SRR8316900	Third green stage	0.112
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.109
	SRR8316899	Complete white stage	0.245
	SRR8316903	Complete white stage	0.126
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.123
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.163
	SRR8316907	Gold flowering stage	0.821
	SRR8316908	Gold flowering stage	3.164
SRP132670	SRR6706286	Control	0.498
	SRR6706287	Light intensity 50%	0.098
	SRR6706288	Light intensity 20%	0.247
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.137
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.803
	CNS0095602	Golden flower (diploid) 2	101.613
	CNS0095603	Golden flower (diploid) 3	99.279
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.118
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.381
	CNS0095613	Golden flower (tetraploid) 1	4.377
	CNS0095614	Golden flower (tetraploid) 2	4.324
	CNS0095615	Golden flower (tetraploid) 3	0.738
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.100
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.070
	CRR073309	Second white 1	0.050
	CRR073310	Second white 2	0.169
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	1.104
	CRR073313	Silver flowering 2	1.420
	CRR073314	Silver flowering 3	4.541
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.060
	CRR073319	Tawny withering 2	0.531
	CRR073320	Tawny withering 3	0.490