Gene detail

Detail information of GWHGAAZE009463

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010275980.1	2.23656E-86	PREDICTED: bis(5'-adenosyl)-triphosphatase [Nelumbo nucifera]
trEMBL	tr\|C6SWJ6\|C6SWJ6_SOYBN	4E-83	Putative uncharacterized protein {ECO:0000313\|EMBL:ACU13619.1}
TAIR10	AT5G58240.1	6E-49	FRAGILE HISTIDINE TRIAD

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	110726219	110729333	+
GWHAAZE00000002	mRNA	110726219	110729333	+
GWHAAZE00000002	exon	110726219	110726327	+
GWHAAZE00000002	exon	110727339	110727390	+
GWHAAZE00000002	exon	110728306	110728432	+
GWHAAZE00000002	exon	110729006	110729104	+
GWHAAZE00000002	exon	110729217	110729333	+
GWHAAZE00000002	CDS	110726219	110726327	+
GWHAAZE00000002	CDS	110727339	110727390	+
GWHAAZE00000002	CDS	110728306	110728432	+
GWHAAZE00000002	CDS	110729006	110729104	+
GWHAAZE00000002	CDS	110729217	110729333	+

Transcript Sequence
>GWHTAAZE009473 ATGAATTCGGAGAAGTATATTTTCGGACCTTACAAAATCGACTCCAAGGAAGTCTTTTACTCCACCGATCTTTCCTATGCCATGGTCAACCTCCGCCCTTTGCTTCCTGGTCATATCCTTTCTTCTCAATTTGAGGACAATTTTCTTGATTTATTGGACATGCGTGAAGTGAAACGCTTTGTTGATCTCACTACTGATGAGACTAGTGATCTATGGATTATGGCGCAAAAAGTTGGCTGTCAGCTTGAGCACCATCATAAGGCATCTTCGCTTACCTTTGCAATTCAGGACGGGCCGCAGGCTGGGCAGACAGTGCCTCATGTTCATATCCACATCATCCCACGAAAAAGTGGTGATTTTGAGAATAATGATGAGATTTATGAGGCTATAGATGAGAAGGAGAAGGAACTGAAGGCTAAACTGGACTTGGACAAGGAGAGGAAAGACAGAACCCTAGAGGACATGGCTATGGAGGCAGCTGAATACAGAAAGCTTTTATTATAG

Network for GWHGAAZE009463

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01230.24	HIT	16	117	1.40E-17

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01522	FHIT	Metabolic pathways	map01100
K01522	FHIT	Purine metabolism	map00230

Gene Ontology

GO term	Ontology	Name
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	31.308
	SRR3591706	second leaf	24.954
	SRR3591707	mature leaf	17.356
	SRR3591708	Shoot apex	43.498
	SRR3591709	Stem	33.722
	SRR3591710	White floral bud	45.833
	SRR3591711	White flower	46.338
	SRR3591712	Green floral bud	44.900
	SRR3591713	Yellow flower	48.309
SRP173429	SRR8316895	Juvenile bud stage	35.281
	SRR8316896	Juvenile bud stage	52.909
	SRR8316897	Juvenile bud stage	30.174
	SRR8316894	Third green stage	21.761
	SRR8316900	Third green stage	56.018
	SRR8316901	Third green stage	57.912
	SRR8316898	Complete white stage	26.869
	SRR8316899	Complete white stage	67.576
	SRR8316903	Complete white stage	38.164
	SRR8316902	Silver flowering stage	28.449
	SRR8316904	Silver flowering stage	29.387
	SRR8316905	Silver flowering stage	17.344
	SRR8316906	Gold flowering stage	56.716
	SRR8316907	Gold flowering stage	62.674
	SRR8316908	Gold flowering stage	69.737
SRP132670	SRR6706286	Control	68.177
	SRR6706287	Light intensity 50%	68.750
	SRR6706288	Light intensity 20%	72.201
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	54.802
	CNS0095593	Slightly white alabastrum(diploid) 2	53.673
	CNS0095594	Slightly white alabastrum(diploid) 3	53.236
	CNS0095595	Whole white alabastrum(diploid) 2	42.985
	CNS0095596	Whole white alabastrum(diploid) 3	48.811
	CNS0095597	Whole white alabastrum(diploid) 4	36.983
	CNS0095598	Silvery flower (diploied) 1	43.925
	CNS0095599	Silvery flower (diploied) 2	46.696
	CNS0095600	Silvery flower (diploied) 3	36.701
	CNS0095601	Golden flower (diploid) 1	44.987
	CNS0095602	Golden flower (diploid) 2	32.639
	CNS0095603	Golden flower (diploid) 3	33.850
	CNS0095604	Slightly white alabastrum(tetraploid) 1	55.823
	CNS0095605	Slightly white alabastrum(tetraploid) 2	61.988
	CNS0095606	Slightly white alabastrum(tetraploid) 3	57.299
	CNS0095607	Whole white alabastrum(tetraploid) 1	46.882
	CNS0095608	Whole white alabastrum(tetraploid) 2	38.192
	CNS0095609	Whole white alabastrum(tetraploid) 3	53.978
	CNS0095610	Silvery flower (tetraploid) 1	49.662
	CNS0095611	Silvery flower (tetraploid) 2	36.619
	CNS0095612	Silvery flower (tetraploid) 3	43.040
	CNS0095613	Golden flower (tetraploid) 1	40.508
	CNS0095614	Golden flower (tetraploid) 2	42.477
	CNS0095615	Golden flower (tetraploid) 3	35.521
CRA001975	CRR073297	Stem 1	43.488
	CRR073298	Stem 2	48.219
	CRR073299	Stem 3	42.471
	CRR073300	Leaf 1	44.963
	CRR073301	Leaf 2	51.553
	CRR073302	Leaf 3	43.150
	CRR073303	Juvenile bud 1	44.118
	CRR073304	Juvenile bud 2	39.480
	CRR073305	Juvenile bud 3	35.748
	CRR073306	Third green 1	26.120
	CRR073307	Third green 2	33.867
	CRR073308	Third green 3	26.170
	CRR073309	Second white 1	32.624
	CRR073310	Second white 2	32.379
	CRR073311	Second white 3	23.364
	CRR073312	Silver flowering 1	25.512
	CRR073313	Silver flowering 2	24.423
	CRR073314	Silver flowering 3	26.522
	CRR073315	Gold flowering 1	39.693
	CRR073316	Gold flowering 2	39.326
	CRR073317	Gold flowering 3	31.866
	CRR073318	Tawny withering 1	41.445
	CRR073319	Tawny withering 2	39.937
	CRR073320	Tawny withering 3	37.936