Gene detail

Detail information of GWHGAAZE009689

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AGS80335.1	2.70571E-79	ethylene response factor [Actinidia eriantha]
Swissprot	tr\|Q8LDC8\|ERF92_ARATH	3E-69	Ethylene-responsive transcription factor 1B
trEMBL	tr\|S5VSG8\|S5VSG8_ACTER	1E-79	Ethylene response factor {ECO:0000313\|EMBL:AGS80335.1}
TAIR10	AT3G23240.1	2E-38	ethylene response factor 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	115250096	115250653	-
GWHAAZE00000002	mRNA	115250096	115250653	-
GWHAAZE00000002	exon	115250564	115250653	-
GWHAAZE00000002	exon	115250096	115250518	-
GWHAAZE00000002	CDS	115250564	115250653	-
GWHAAZE00000002	CDS	115250096	115250518	-

Transcript Sequence
>GWHTAAZE009701 ATGCTTCTGTTGGGTGTTCTAGCTGAAGGAGCAAGGGAGTCCTCGGATACTAATTCTGACGCCAGGGTTAAAGAAGAGGAATCCAATTCCGACCCCAAGAAGGAAAAGTCTTATAGAGGGGTACGTAGACGACCTTGGGGAAAGTTTGCAGCAGAGATAAGGGATTCCACAAGAAATGGAATCCGTGTTTGGCTAGGAACATTTGATAATGCCGAGGCAGCTGCTATGGCTTATGATCAGGCTGCATTTTCAATGAGGGGATCAATGGCGGTCCTCAACTTTCCAGTGGAGAGAGTAAAGGAATCGCTTCTTGAGTTGAAGTGTGGGATTGAAGAAGGGTGCTCGCCCGTGATGGCTTTGAAGAAGAGACATTCTATGAGGAAAAAATCCGTAAATAGAAAGAATAAAGTTAAGGAGGCAAAAATGGACAGTACTGTGGTGGTATTCCAAGACTTGGGAGCTGAATATTTGGAGGAACTATTGAGTTCCTCTGAGAATGCTAGTACATGGTGA

Network for GWHGAAZE009689

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	37	87	1.80E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
K14516	ERF1	MAPK signaling pathway - plant	map04016
K14516	ERF1	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.687
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	3.702
	SRR3591708	Shoot apex	0.594
	SRR3591709	Stem	18.735
	SRR3591710	White floral bud	2.036
	SRR3591711	White flower	16.066
	SRR3591712	Green floral bud	0.206
	SRR3591713	Yellow flower	6.315
SRP173429	SRR8316895	Juvenile bud stage	0.631
	SRR8316896	Juvenile bud stage	0.403
	SRR8316897	Juvenile bud stage	1.131
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.164
	SRR8316902	Silver flowering stage	0.413
	SRR8316904	Silver flowering stage	0.646
	SRR8316905	Silver flowering stage	0.742
	SRR8316906	Gold flowering stage	3.670
	SRR8316907	Gold flowering stage	3.779
	SRR8316908	Gold flowering stage	13.147
SRP132670	SRR6706286	Control	0.148
	SRR6706287	Light intensity 50%	0.265
	SRR6706288	Light intensity 20%	0.210
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.268
	CNS0095593	Slightly white alabastrum(diploid) 2	0.136
	CNS0095594	Slightly white alabastrum(diploid) 3	0.773
	CNS0095595	Whole white alabastrum(diploid) 2	0.128
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	1.071
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.190
	CNS0095600	Silvery flower (diploied) 3	0.818
	CNS0095601	Golden flower (diploid) 1	0.434
	CNS0095602	Golden flower (diploid) 2	1.236
	CNS0095603	Golden flower (diploid) 3	1.846
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.320
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.146
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.280
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.123
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.092
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	2.545
	CNS0095611	Silvery flower (tetraploid) 2	0.735
	CNS0095612	Silvery flower (tetraploid) 3	0.427
	CNS0095613	Golden flower (tetraploid) 1	14.463
	CNS0095614	Golden flower (tetraploid) 2	4.918
	CNS0095615	Golden flower (tetraploid) 3	3.013
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.050
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.021
	CRR073311	Second white 3	0.204
	CRR073312	Silver flowering 1	0.932
	CRR073313	Silver flowering 2	0.851
	CRR073314	Silver flowering 3	0.099
	CRR073315	Gold flowering 1	0.094
	CRR073316	Gold flowering 2	3.477
	CRR073317	Gold flowering 3	12.969
	CRR073318	Tawny withering 1	0.298
	CRR073319	Tawny withering 2	5.840
	CRR073320	Tawny withering 3	0.291