Gene detail

Detail information of GWHGAAZE009709

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002262985.1	3.61572E-65	PREDICTED: bet1-like SNARE 1-1 [Vitis vinifera]
Swissprot	tr\|Q9M2J9\|BET11_ARATH	4E-59	Bet1-like SNARE 1-1
trEMBL	tr\|D7U2W9\|D7U2W9_VITVI	1E-65	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI37085.3}
TAIR10	AT3G58170.1	8E-47	BET1P/SFT1P-like protein 14A

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	115556897	115558639	+
GWHAAZE00000002	mRNA	115556897	115558639	+
GWHAAZE00000002	exon	115556897	115556904	+
GWHAAZE00000002	exon	115556988	115557141	+
GWHAAZE00000002	exon	115558072	115558128	+
GWHAAZE00000002	exon	115558196	115558255	+
GWHAAZE00000002	exon	115558344	115558639	+
GWHAAZE00000002	CDS	115556897	115556904	+
GWHAAZE00000002	CDS	115556988	115557141	+
GWHAAZE00000002	CDS	115558072	115558128	+
GWHAAZE00000002	CDS	115558196	115558255	+
GWHAAZE00000002	CDS	115558344	115558433	+
GWHAAZE00000002	three_prime_UTR	115558434	115558639	+

Transcript Sequence
>GWHTAAZE009721 ATGGGTGGGGACTACCGTGGTAACAGAGCTGCTCTTTTCAATGATGTCGAGGAAGGAGGTATTAGGGTGTCAACTTCTAAGTACTCCACCCATGAAATAGATGAACACGAGAATTATAGAGCGATGGAGGGTTTGGAAGATAGAGTTATTATGCTGAAAAGATTAACAGGTGATATCCATGAGGAAGTGGAGAGTCATAATCGTATGCTGGATAGAATGGGCAATGATATGGACTCATCAAGGGGTGTACTCTCAGGAACTATGGATAAATTCAAGATGGTATTTGAGACCAAATCAAGCCGGAGAATGTTTACGCTTGTGGCATCATTTGTGGTGATTTTTCTGATTATATATTATCTCACTAGGTAAATAATTAGCTTGATGAATTTGAACAACTTCATCTTTTCTGTTTAGAAGTGGGGATGCATTTTGTCAAAATTAGAAACTACCCGTAAGATATTCTTCTTGCAATGTGTGTTTGTGAATACACCCCCTTGTATTGGGCAATTTGCTATGCCAATGGAGTTATTATACTGCCAACATTATGGAAATTTTATTTGCATCCCGACTTTCTA

Network for GWHGAAZE009709

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0270

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K08504	BET1	SNARE interactions in vesicular transport	map04130

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	39.657
	SRR3591706	second leaf	14.006
	SRR3591707	mature leaf	10.645
	SRR3591708	Shoot apex	48.050
	SRR3591709	Stem	28.691
	SRR3591710	White floral bud	20.718
	SRR3591711	White flower	15.846
	SRR3591712	Green floral bud	27.427
	SRR3591713	Yellow flower	11.500
SRP173429	SRR8316895	Juvenile bud stage	8.780
	SRR8316896	Juvenile bud stage	19.287
	SRR8316897	Juvenile bud stage	7.019
	SRR8316894	Third green stage	8.312
	SRR8316900	Third green stage	23.131
	SRR8316901	Third green stage	18.580
	SRR8316898	Complete white stage	3.998
	SRR8316899	Complete white stage	20.131
	SRR8316903	Complete white stage	8.816
	SRR8316902	Silver flowering stage	4.747
	SRR8316904	Silver flowering stage	4.763
	SRR8316905	Silver flowering stage	2.594
	SRR8316906	Gold flowering stage	6.757
	SRR8316907	Gold flowering stage	7.063
	SRR8316908	Gold flowering stage	4.522
SRP132670	SRR6706286	Control	6.420
	SRR6706287	Light intensity 50%	8.007
	SRR6706288	Light intensity 20%	9.012
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	34.020
	CNS0095593	Slightly white alabastrum(diploid) 2	37.093
	CNS0095594	Slightly white alabastrum(diploid) 3	26.586
	CNS0095595	Whole white alabastrum(diploid) 2	27.870
	CNS0095596	Whole white alabastrum(diploid) 3	30.071
	CNS0095597	Whole white alabastrum(diploid) 4	26.714
	CNS0095598	Silvery flower (diploied) 1	24.053
	CNS0095599	Silvery flower (diploied) 2	23.450
	CNS0095600	Silvery flower (diploied) 3	8.979
	CNS0095601	Golden flower (diploid) 1	15.993
	CNS0095602	Golden flower (diploid) 2	7.827
	CNS0095603	Golden flower (diploid) 3	6.365
	CNS0095604	Slightly white alabastrum(tetraploid) 1	45.016
	CNS0095605	Slightly white alabastrum(tetraploid) 2	39.084
	CNS0095606	Slightly white alabastrum(tetraploid) 3	42.851
	CNS0095607	Whole white alabastrum(tetraploid) 1	37.587
	CNS0095608	Whole white alabastrum(tetraploid) 2	28.016
	CNS0095609	Whole white alabastrum(tetraploid) 3	29.710
	CNS0095610	Silvery flower (tetraploid) 1	11.674
	CNS0095611	Silvery flower (tetraploid) 2	10.656
	CNS0095612	Silvery flower (tetraploid) 3	14.774
	CNS0095613	Golden flower (tetraploid) 1	9.129
	CNS0095614	Golden flower (tetraploid) 2	12.736
	CNS0095615	Golden flower (tetraploid) 3	3.326
CRA001975	CRR073297	Stem 1	4.628
	CRR073298	Stem 2	5.868
	CRR073299	Stem 3	2.703
	CRR073300	Leaf 1	7.938
	CRR073301	Leaf 2	5.658
	CRR073302	Leaf 3	3.876
	CRR073303	Juvenile bud 1	1.958
	CRR073304	Juvenile bud 2	2.704
	CRR073305	Juvenile bud 3	3.213
	CRR073306	Third green 1	0.891
	CRR073307	Third green 2	0.426
	CRR073308	Third green 3	0.845
	CRR073309	Second white 1	1.270
	CRR073310	Second white 2	1.588
	CRR073311	Second white 3	0.589
	CRR073312	Silver flowering 1	0.370
	CRR073313	Silver flowering 2	1.951
	CRR073314	Silver flowering 3	0.727
	CRR073315	Gold flowering 1	0.971
	CRR073316	Gold flowering 2	0.615
	CRR073317	Gold flowering 3	0.999
	CRR073318	Tawny withering 1	4.287
	CRR073319	Tawny withering 2	3.693
	CRR073320	Tawny withering 3	4.565