Gene detail

Detail information of GWHGAAZE009737

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU46538.1	2.31208E-62	hypothetical protein MIMGU_mgv1a016029mg [Erythranthe guttata]
Swissprot	tr\|O23628\|H2AV1_ARATH	1E-62	Histone H2A variant 1
trEMBL	tr\|A0A022S3N5\|A0A022S3N5_ERYGU	9E-63	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT3G54560.1	2E-49	histone H2A 11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	116219791	116220087	+
GWHAAZE00000002	mRNA	116219791	116220087	+
GWHAAZE00000002	exon	116219791	116220087	+
GWHAAZE00000002	CDS	116219791	116220087	+

Transcript Sequence
>GWHTAAZE009749 TTTCCAGTGGGTCGAATTCACCGCCACCTCAAAACAAGAACTTCCGCACATGGCCGAGTTGGGGCCACAGCTGCCGTCTACTCAGCCGCAATCCTCGAATACCTAACTGCCGAGGTCCTAGAGTTAGCCGGAAACGCGAGCAAAGATCTGAAAGTGAAGAGAATAACACCAAGGCATTTGCAGTTGGCCATACGTGGTGATGAGGAGCTTGACACGCTTATCAAAGGAACCATTGCTGGTGGTGGTGTCATTCCTCACATTCACAAGTCCCTCATTAACAAGACCACAAAGGAATGA

Network for GWHGAAZE009737

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00125.25	Histone	1	67	1.40E-16
PF16211.6	Histone_H2A_C	68	97	2.50E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0046982	molecular_function	protein heterodimerization activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	189.946
	SRR3591706	second leaf	58.407
	SRR3591707	mature leaf	4.510
	SRR3591708	Shoot apex	746.840
	SRR3591709	Stem	61.377
	SRR3591710	White floral bud	12.461
	SRR3591711	White flower	4.626
	SRR3591712	Green floral bud	20.025
	SRR3591713	Yellow flower	0.117
SRP173429	SRR8316895	Juvenile bud stage	55.051
	SRR8316896	Juvenile bud stage	48.884
	SRR8316897	Juvenile bud stage	36.547
	SRR8316894	Third green stage	14.522
	SRR8316900	Third green stage	5.506
	SRR8316901	Third green stage	13.368
	SRR8316898	Complete white stage	0.145
	SRR8316899	Complete white stage	8.057
	SRR8316903	Complete white stage	3.122
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.230
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	7.766
	SRR6706287	Light intensity 50%	8.371
	SRR6706288	Light intensity 20%	12.234
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	62.469
	CNS0095593	Slightly white alabastrum(diploid) 2	45.059
	CNS0095594	Slightly white alabastrum(diploid) 3	38.933
	CNS0095595	Whole white alabastrum(diploid) 2	16.745
	CNS0095596	Whole white alabastrum(diploid) 3	7.714
	CNS0095597	Whole white alabastrum(diploid) 4	6.474
	CNS0095598	Silvery flower (diploied) 1	21.014
	CNS0095599	Silvery flower (diploied) 2	34.554
	CNS0095600	Silvery flower (diploied) 3	8.209
	CNS0095601	Golden flower (diploid) 1	9.912
	CNS0095602	Golden flower (diploid) 2	5.506
	CNS0095603	Golden flower (diploid) 3	4.849
	CNS0095604	Slightly white alabastrum(tetraploid) 1	57.490
	CNS0095605	Slightly white alabastrum(tetraploid) 2	60.844
	CNS0095606	Slightly white alabastrum(tetraploid) 3	83.648
	CNS0095607	Whole white alabastrum(tetraploid) 1	27.697
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.406
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.973
	CNS0095610	Silvery flower (tetraploid) 1	0.242
	CNS0095611	Silvery flower (tetraploid) 2	3.089
	CNS0095612	Silvery flower (tetraploid) 3	1.510
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.325
CRA001975	CRR073297	Stem 1	67.082
	CRR073298	Stem 2	69.545
	CRR073299	Stem 3	127.853
	CRR073300	Leaf 1	11.123
	CRR073301	Leaf 2	12.521
	CRR073302	Leaf 3	14.869
	CRR073303	Juvenile bud 1	5.367
	CRR073304	Juvenile bud 2	1.157
	CRR073305	Juvenile bud 3	4.383
	CRR073306	Third green 1	0.902
	CRR073307	Third green 2	1.178
	CRR073308	Third green 3	1.162
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	3.315
	CRR073316	Gold flowering 2	3.675
	CRR073317	Gold flowering 3	6.635
	CRR073318	Tawny withering 1	111.398
	CRR073319	Tawny withering 2	82.179
	CRR073320	Tawny withering 3	133.993