Gene detail

Detail information of GWHGAAZE009876

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011079703.1	4.615E-132	PREDICTED: dephospho-CoA kinase [Sesamum indicum]
Swissprot	tr\|Q9ZQH0\|COAE_ARATH	6E-114	Dephospho-CoA kinase
trEMBL	tr\|A0A059A867\|A0A059A867_EUCGR	7E-132	Uncharacterized protein {ECO:0000313\|EMBL:KCW50008.1}
TAIR10	AT2G27490.2	3E-83	dephospho-CoA kinase family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	119009490	119010994	+
GWHAAZE00000002	mRNA	119009490	119010994	+
GWHAAZE00000002	exon	119009490	119009597	+
GWHAAZE00000002	exon	119010002	119010147	+
GWHAAZE00000002	exon	119010553	119010994	+
GWHAAZE00000002	CDS	119009490	119009597	+
GWHAAZE00000002	CDS	119010002	119010147	+
GWHAAZE00000002	CDS	119010553	119010994	+

Transcript Sequence
>GWHTAAZE009888 ATGAGAATAGTAGGGTTGACGGGAGGAATCGGAACAGGGAAGAGTGCTGTTTCCAATCTTTTCAAGGCTTATGGCATTCCCGTAGTCGACGCTGACCTCGTCGCTCGCGATGTTTTGAAGAAAGGTACTGGCGGTTGGAGAAAAGCTGTGGCAGCATTTGGCCAGGACATATTACAGCCAAATGGAGAAGTTGATCGCCCAAAGCTGGGCCAATTAATATTTTCTGATAACGCAAAGCGCCAGCTTCTTAATAGGTTGCTGGCACCTTATATTTCATCTGGTATTCTCTGCGAAATTTTGAAGTTATGGATGAAGGGTTACAAAGTTATCGTTCTTGACGTTCCTTTGTTGTTCGAGGCCCAGATGGACAGGTGGACAAAGCCCATTATTGTGGTGTGGGTTGATCCTGAAACACAGCTTCAAAGACTCATGGCAAGAGACAGAACATCGATGGAAGATGCCAAAAAAAGGATATATTCTCAGATGCCTCTTGATTTGAAAAGAACTCAGGCAGATATAGTGATTGATAACTGTGGATCCCTAGAGGATTTGAATGAACATTTCAGAAAGGTATTGACCCAGGTCTCAAAGCCTTTGACCTGGACTGAGTTTGGGCTTTCAAGACAGGGAGCTTTTCTAGCTCTTATATCTATTTTTGTGGGTGTTATCCTATGCAGGAAAATTTCAAAGTTGTAA

Network for GWHGAAZE009876

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01121.21	CoaE	3	182	6.50E-58

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00859	coaE	Metabolic pathways	map01100
K00859	coaE	Pantothenate and CoA biosynthesis	map00770

Gene Ontology

GO term	Ontology	Name
GO:0015937	biological_process	coenzyme A biosynthetic process
GO:0004140	molecular_function	dephospho-CoA kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	19.091
	SRR3591706	second leaf	13.911
	SRR3591707	mature leaf	12.847
	SRR3591708	Shoot apex	20.236
	SRR3591709	Stem	25.916
	SRR3591710	White floral bud	17.797
	SRR3591711	White flower	28.150
	SRR3591712	Green floral bud	22.588
	SRR3591713	Yellow flower	20.872
SRP173429	SRR8316895	Juvenile bud stage	13.632
	SRR8316896	Juvenile bud stage	17.564
	SRR8316897	Juvenile bud stage	11.889
	SRR8316894	Third green stage	9.911
	SRR8316900	Third green stage	33.509
	SRR8316901	Third green stage	22.756
	SRR8316898	Complete white stage	9.959
	SRR8316899	Complete white stage	42.481
	SRR8316903	Complete white stage	12.994
	SRR8316902	Silver flowering stage	8.434
	SRR8316904	Silver flowering stage	11.073
	SRR8316905	Silver flowering stage	6.857
	SRR8316906	Gold flowering stage	20.157
	SRR8316907	Gold flowering stage	19.967
	SRR8316908	Gold flowering stage	23.870
SRP132670	SRR6706286	Control	17.992
	SRR6706287	Light intensity 50%	17.664
	SRR6706288	Light intensity 20%	21.022
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	20.880
	CNS0095593	Slightly white alabastrum(diploid) 2	20.433
	CNS0095594	Slightly white alabastrum(diploid) 3	19.207
	CNS0095595	Whole white alabastrum(diploid) 2	18.506
	CNS0095596	Whole white alabastrum(diploid) 3	22.881
	CNS0095597	Whole white alabastrum(diploid) 4	19.408
	CNS0095598	Silvery flower (diploied) 1	15.387
	CNS0095599	Silvery flower (diploied) 2	22.282
	CNS0095600	Silvery flower (diploied) 3	19.434
	CNS0095601	Golden flower (diploid) 1	15.996
	CNS0095602	Golden flower (diploid) 2	17.469
	CNS0095603	Golden flower (diploid) 3	17.472
	CNS0095604	Slightly white alabastrum(tetraploid) 1	24.098
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.700
	CNS0095606	Slightly white alabastrum(tetraploid) 3	30.460
	CNS0095607	Whole white alabastrum(tetraploid) 1	18.959
	CNS0095608	Whole white alabastrum(tetraploid) 2	22.042
	CNS0095609	Whole white alabastrum(tetraploid) 3	31.111
	CNS0095610	Silvery flower (tetraploid) 1	36.836
	CNS0095611	Silvery flower (tetraploid) 2	34.880
	CNS0095612	Silvery flower (tetraploid) 3	32.049
	CNS0095613	Golden flower (tetraploid) 1	21.298
	CNS0095614	Golden flower (tetraploid) 2	28.653
	CNS0095615	Golden flower (tetraploid) 3	19.313
CRA001975	CRR073297	Stem 1	15.590
	CRR073298	Stem 2	14.447
	CRR073299	Stem 3	12.881
	CRR073300	Leaf 1	22.046
	CRR073301	Leaf 2	20.005
	CRR073302	Leaf 3	17.299
	CRR073303	Juvenile bud 1	19.587
	CRR073304	Juvenile bud 2	15.935
	CRR073305	Juvenile bud 3	14.864
	CRR073306	Third green 1	4.586
	CRR073307	Third green 2	7.053
	CRR073308	Third green 3	6.560
	CRR073309	Second white 1	2.963
	CRR073310	Second white 2	3.152
	CRR073311	Second white 3	3.358
	CRR073312	Silver flowering 1	2.377
	CRR073313	Silver flowering 2	3.223
	CRR073314	Silver flowering 3	1.853
	CRR073315	Gold flowering 1	10.615
	CRR073316	Gold flowering 2	8.155
	CRR073317	Gold flowering 3	8.953
	CRR073318	Tawny withering 1	17.894
	CRR073319	Tawny withering 2	15.914
	CRR073320	Tawny withering 3	16.262