Gene detail

Detail information of GWHGAAZE009882

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO87274.1	4.6484E-144	hypothetical protein CISIN_1g047888mg [Citrus sinensis]
Swissprot	tr\|B9DGU7\|TPK1_ARATH	2E-134	Thiamine pyrophosphokinase 1
trEMBL	tr\|A0A067H609\|A0A067H609_CITSI	2E-144	Uncharacterized protein {ECO:0000313\|EMBL:KDO87274.1}
TAIR10	AT1G02880.3	8E-94	thiamin pyrophosphokinase1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	119145276	119151375	+
GWHAAZE00000002	mRNA	119145276	119151375	+
GWHAAZE00000002	exon	119145276	119145460	+
GWHAAZE00000002	exon	119145557	119145658	+
GWHAAZE00000002	exon	119147092	119147164	+
GWHAAZE00000002	exon	119148465	119148566	+
GWHAAZE00000002	exon	119150658	119150907	+
GWHAAZE00000002	exon	119151257	119151375	+
GWHAAZE00000002	CDS	119145276	119145460	+
GWHAAZE00000002	CDS	119145557	119145658	+
GWHAAZE00000002	CDS	119147092	119147164	+
GWHAAZE00000002	CDS	119148465	119148566	+
GWHAAZE00000002	CDS	119150658	119150907	+
GWHAAZE00000002	CDS	119151257	119151375	+

Transcript Sequence
>GWHTAAZE009894 ATGGACCTAATGACTCATTCTTCAACCTTCCTCCTCCCTTCAATTCCTGCCGACAGCGGCTCCTCCTCCGCTCTAACCTACGCACTTGTTATTCTTAACCAACGTATTCCTCGCTTCACTCCCCTCCTATGGAAGCACGGTACCGTATCTCACTTCCTCGTTCATCACCTCTTTCTCTTTCTAGGAGCAGCACACCTTCGTATCTGTGCGGATGGTGGAGCTAATCGCGTTTTCGACGAGTTGCCTCATCTTTTTCCTCATGAAGAGCTATTAGCTATTAGAAACAGGTACAAACCAGATGTTATAAAGGGGGACATGGATTCAGTAAGAAAAGAAGTTCTAAGTTTCTATGCAAACCTGGGAACCAAGATATTAGACGAGTCCCACGACCAGGATACCACTGATTTACATAAATGTGTTGCATATATTTGTGATTCCACGCCACACCTGGAGAAGTCTAATTTATGCATTCTTGTTGCTGGAGCACTAGGTGGAAGGTTTGACCATGAAGTAGGAAATATCAATGTTCTATGCCGTTTTTCAACCACGCGAATAATTCTTTTATCAGAAGATTGTTATATCCAACTTCTTCCAAGTACCCACCATCACGAGATCCATATTCAGTCCTCTGTTGAAGGCCCCCATTGTGGACTCATTCCCATTAGTGGGCCATCTGGAAGTACTACAACCACTGGGCTCCAGTGGGATCTCACTGATACAGAAATGAGATTTGGTGGATTAATCAGTACATCAAATATTGTGAAGGAAGAGAAAATTACTGTGAAATCCGATTCTGATCTTCTTTGGACGATATCCATTAGAAAGCCTTGA

Network for GWHGAAZE009882

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04263.17	TPK_catalytic	63	185	2.90E-37
PF04265.15	TPK_B1_binding	202	268	1.70E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00949	thiN, TPK1, THI80	Metabolic pathways	map01100
K00949	thiN, TPK1, THI80	Thiamine metabolism	map00730

Gene Ontology

GO term	Ontology	Name
GO:0009229	biological_process	thiamine diphosphate biosynthetic process
GO:0006772	biological_process	thiamine metabolic process
GO:0004788	molecular_function	thiamine diphosphokinase activity
GO:0005524	molecular_function	ATP binding
GO:0030975	molecular_function	thiamine binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.689
	SRR3591706	second leaf	13.528
	SRR3591707	mature leaf	24.866
	SRR3591708	Shoot apex	16.536
	SRR3591709	Stem	23.439
	SRR3591710	White floral bud	25.109
	SRR3591711	White flower	32.734
	SRR3591712	Green floral bud	18.825
	SRR3591713	Yellow flower	62.578
SRP173429	SRR8316895	Juvenile bud stage	9.885
	SRR8316896	Juvenile bud stage	19.254
	SRR8316897	Juvenile bud stage	8.458
	SRR8316894	Third green stage	7.475
	SRR8316900	Third green stage	21.028
	SRR8316901	Third green stage	19.015
	SRR8316898	Complete white stage	6.934
	SRR8316899	Complete white stage	21.462
	SRR8316903	Complete white stage	20.318
	SRR8316902	Silver flowering stage	15.644
	SRR8316904	Silver flowering stage	29.478
	SRR8316905	Silver flowering stage	13.222
	SRR8316906	Gold flowering stage	51.989
	SRR8316907	Gold flowering stage	37.504
	SRR8316908	Gold flowering stage	42.982
SRP132670	SRR6706286	Control	18.371
	SRR6706287	Light intensity 50%	18.429
	SRR6706288	Light intensity 20%	16.666
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.596
	CNS0095593	Slightly white alabastrum(diploid) 2	10.070
	CNS0095594	Slightly white alabastrum(diploid) 3	15.709
	CNS0095595	Whole white alabastrum(diploid) 2	11.391
	CNS0095596	Whole white alabastrum(diploid) 3	8.842
	CNS0095597	Whole white alabastrum(diploid) 4	12.132
	CNS0095598	Silvery flower (diploied) 1	11.772
	CNS0095599	Silvery flower (diploied) 2	11.217
	CNS0095600	Silvery flower (diploied) 3	25.785
	CNS0095601	Golden flower (diploid) 1	16.477
	CNS0095602	Golden flower (diploid) 2	33.491
	CNS0095603	Golden flower (diploid) 3	29.103
	CNS0095604	Slightly white alabastrum(tetraploid) 1	15.432
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.475
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.282
	CNS0095607	Whole white alabastrum(tetraploid) 1	14.426
	CNS0095608	Whole white alabastrum(tetraploid) 2	14.945
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.197
	CNS0095610	Silvery flower (tetraploid) 1	37.783
	CNS0095611	Silvery flower (tetraploid) 2	33.793
	CNS0095612	Silvery flower (tetraploid) 3	34.043
	CNS0095613	Golden flower (tetraploid) 1	35.676
	CNS0095614	Golden flower (tetraploid) 2	34.929
	CNS0095615	Golden flower (tetraploid) 3	58.528
CRA001975	CRR073297	Stem 1	9.035
	CRR073298	Stem 2	9.739
	CRR073299	Stem 3	7.621
	CRR073300	Leaf 1	10.509
	CRR073301	Leaf 2	11.257
	CRR073302	Leaf 3	7.265
	CRR073303	Juvenile bud 1	10.867
	CRR073304	Juvenile bud 2	8.414
	CRR073305	Juvenile bud 3	8.935
	CRR073306	Third green 1	12.513
	CRR073307	Third green 2	8.819
	CRR073308	Third green 3	12.423
	CRR073309	Second white 1	20.184
	CRR073310	Second white 2	16.357
	CRR073311	Second white 3	15.794
	CRR073312	Silver flowering 1	20.243
	CRR073313	Silver flowering 2	17.388
	CRR073314	Silver flowering 3	12.189
	CRR073315	Gold flowering 1	10.404
	CRR073316	Gold flowering 2	9.915
	CRR073317	Gold flowering 3	10.351
	CRR073318	Tawny withering 1	9.895
	CRR073319	Tawny withering 2	13.595
	CRR073320	Tawny withering 3	12.226