Gene detail

Detail information of GWHGAAZE010040

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_009091713.1	1.7027E-137	NADH dehydrogenase subunit 9 (mitochondrion) [Panax ginseng]
Swissprot	tr\|Q95748\|NDUS3_ARATH	6E-129	NADH dehydrogenase [ubiquinone] iron-sulfur protein 3
trEMBL	tr\|A0A096XF79\|A0A096XF79_PANGI	6E-138	NADH dehydrogenase subunit 9 {ECO:0000313\|EMBL:AHJ80999.1}
TAIR10	ATMG00070.1	2E-106	NADH dehydrogenase subunit 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	122437584	122438156	-
GWHAAZE00000002	mRNA	122437584	122438156	-
GWHAAZE00000002	exon	122437584	122438156	-
GWHAAZE00000002	CDS	122437584	122438156	-

Transcript Sequence
>GWHTAAZE010052 ATGGATAACCAATTCATTTTCAAATATAGTTGGGAGACTTTACCCAAGAAATGGGTCCAAAAAATGGAAAGATCGGAACATGGGAATAGATCTGATACCAATACGGACTACCCATTTCAATTGTTGTGCTTTCTGAAATTGCATACCTATACAAGGGTTCAAGTTTCGATCGATATTTGCGGAGTTGATCATCCCTCTCGAAAACGAAGATTTGAAGTGGTCTATAATTTACTGAGTACTCGGTATAACTCACGCATTCGTGTACAAACCAGTGCAGACGAAGTAACACGAATATCTCCGGTAGTCAGTCCATTTCCATCAGCCGGCCGGTGGGAGCGAGAAGTTTGGGATATGTTTGGTGTTTCTTCCATCAATCATCCGGATCTACGCCGTATATCAACAGATTATGGTTTCGAGGGTCATCCATTACGAAAAGACCTTCCTCTGAGTGGATATGTGGAAGTACGCTATGATGATCCAGAGAAACGTGTGGTTTCTGAACCCATTGAGATGACCCAAGAATTTCGCTATTTCGATTCTGCTAGTCCTTGGGAACAGCGTAGCGACGGATAA

Network for GWHGAAZE010040

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00329.20	Complex1_30kDa	41	152	1.50E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03936	NDUFS3	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Retrograde endocannabinoid signaling	map04723
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0008137	molecular_function	NADH dehydrogenase (ubiquinone) activity
GO:0016651	molecular_function	oxidoreductase activity, acting on NAD(P)H

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.221
	SRR3591706	second leaf	0.042
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.498
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.068
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.314
	SRR3591713	Yellow flower	0.218
SRP173429	SRR8316895	Juvenile bud stage	9.167
	SRR8316896	Juvenile bud stage	4.833
	SRR8316897	Juvenile bud stage	22.684
	SRR8316894	Third green stage	18.634
	SRR8316900	Third green stage	2.010
	SRR8316901	Third green stage	1.908
	SRR8316898	Complete white stage	9.764
	SRR8316899	Complete white stage	0.212
	SRR8316903	Complete white stage	12.129
	SRR8316902	Silver flowering stage	17.744
	SRR8316904	Silver flowering stage	16.148
	SRR8316905	Silver flowering stage	14.894
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.398
	SRR8316908	Gold flowering stage	0.207
SRP132670	SRR6706286	Control	0.238
	SRR6706287	Light intensity 50%	0.285
	SRR6706288	Light intensity 20%	0.578
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	7.802
	CNS0095593	Slightly white alabastrum(diploid) 2	6.109
	CNS0095594	Slightly white alabastrum(diploid) 3	6.264
	CNS0095595	Whole white alabastrum(diploid) 2	9.195
	CNS0095596	Whole white alabastrum(diploid) 3	6.153
	CNS0095597	Whole white alabastrum(diploid) 4	12.896
	CNS0095598	Silvery flower (diploied) 1	7.887
	CNS0095599	Silvery flower (diploied) 2	4.909
	CNS0095600	Silvery flower (diploied) 3	1.055
	CNS0095601	Golden flower (diploid) 1	7.269
	CNS0095602	Golden flower (diploid) 2	0.527
	CNS0095603	Golden flower (diploid) 3	1.681
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.719
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.958
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.057
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.398
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.199
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.256
	CNS0095610	Silvery flower (tetraploid) 1	2.566
	CNS0095611	Silvery flower (tetraploid) 2	0.948
	CNS0095612	Silvery flower (tetraploid) 3	0.709
	CNS0095613	Golden flower (tetraploid) 1	6.491
	CNS0095614	Golden flower (tetraploid) 2	1.644
	CNS0095615	Golden flower (tetraploid) 3	0.147
CRA001975	CRR073297	Stem 1	1.591
	CRR073298	Stem 2	0.580
	CRR073299	Stem 3	0.193
	CRR073300	Leaf 1	0.178
	CRR073301	Leaf 2	0.614
	CRR073302	Leaf 3	0.211
	CRR073303	Juvenile bud 1	2.053
	CRR073304	Juvenile bud 2	2.488
	CRR073305	Juvenile bud 3	1.894
	CRR073306	Third green 1	0.925
	CRR073307	Third green 2	0.620
	CRR073308	Third green 3	0.951
	CRR073309	Second white 1	0.370
	CRR073310	Second white 2	3.764
	CRR073311	Second white 3	8.868
	CRR073312	Silver flowering 1	5.192
	CRR073313	Silver flowering 2	1.409
	CRR073314	Silver flowering 3	4.084
	CRR073315	Gold flowering 1	1.257
	CRR073316	Gold flowering 2	0.369
	CRR073317	Gold flowering 3	1.708
	CRR073318	Tawny withering 1	0.197
	CRR073319	Tawny withering 2	0.391
	CRR073320	Tawny withering 3	1.349