Gene detail

Detail information of GWHGAAZE010046

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_009091726.1	0	cytochrome c oxidase subunit 3 (mitochondrion) [Panax ginseng]
Swissprot	tr\|P32808\|COX3_HELAN	0	Cytochrome c oxidase subunit 3
trEMBL	tr\|A0A096XF86\|A0A096XF86_PANGI	0	Cytochrome c oxidase subunit 3 {ECO:0000313\|EMBL:AHJ81009.1}
TAIR10	ATMG00730.1	5E-135	cytochrome c oxidase subunit 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	122506847	122507644	-
GWHAAZE00000002	mRNA	122506847	122507644	-
GWHAAZE00000002	exon	122506847	122507644	-
GWHAAZE00000002	CDS	122506847	122507644	-

Transcript Sequence
>GWHTAAZE010058 ATGATTGAATCTCAGAGGCATTCTTATCATTTGGTAGATCCAAGTCCATGGCCTATTTCGGGTTCACTCGGAGCTTTGGCAACCACCGTAGGAGGTGTGATGTACATGCACCCATTTCAAGGGGGCGCAACACTTCTCAGTTTGGGCCTCATCTTTCTCCTATATACCATGTTCGTATGGTGGCGCGATGTTCTACGTGAATCCACGTTGGAAGGACATCATACCAAAGTCGTACAATTAGGACCTCGATATGGTTTTCTTCTGTTTATCGTATCGGAGGTTATGTTCCTTTTTGCTCTTTTTCGGGCTTCTTCTCATTCTTCTTTGGCACCTACGGTAGAGATCGGAGGTATTTGGCCCCCAAAAGGGATTTTGGTTTTAGATCCTCGGGAAATCCCTTTTCTTAATACCCTTATTCCCCCTTCATCCGGAGCTGCCGTAACTTGGGCTCATCATGCTATACTCGCGGGGAAGGAAAAACGAGCAGTTTACGCTTTAGTAGCTACCGTTTCACTGGCTCTAGTATTCACTGGCTTTCAAGGAATGGAATATTATCAAGCACCCTCCACTATTTCGGATAGTATTTATGGTTCTACCTTTTTCTTAGCAACTGGCTTTCATGGTTTTCATGTGATTATAGGTACTCTTTTCTCGATCATATGTGGTATTCGCCAATATCTTGGTCATCTGACCAAGGAGCATCACGTTGGCTTTGAAGCAGCTGCATGGTACTGGCATTTTGTAGACGTGGTTCGGTTATTCCCATTTGTCTCTATCTATTGGTGGGGAGGTATATGA

Network for GWHGAAZE010046

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00510.19	COX3	7	263	1.90E-104

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02262	COX3	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Cardiac muscle contraction	map04260
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0022904	biological_process	respiratory electron transport chain
GO:0016020	cellular_component	membrane
GO:0004129	molecular_function	cytochrome-c oxidase activity
GO:0015002	molecular_function	heme-copper terminal oxidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.216
	SRR3591706	second leaf	0.469
	SRR3591707	mature leaf	0.467
	SRR3591708	Shoot apex	1.956
	SRR3591709	Stem	0.422
	SRR3591710	White floral bud	0.577
	SRR3591711	White flower	0.461
	SRR3591712	Green floral bud	0.643
	SRR3591713	Yellow flower	0.435
SRP173429	SRR8316895	Juvenile bud stage	24.030
	SRR8316896	Juvenile bud stage	17.599
	SRR8316897	Juvenile bud stage	46.739
	SRR8316894	Third green stage	52.432
	SRR8316900	Third green stage	7.721
	SRR8316901	Third green stage	3.148
	SRR8316898	Complete white stage	22.461
	SRR8316899	Complete white stage	0.666
	SRR8316903	Complete white stage	23.126
	SRR8316902	Silver flowering stage	30.995
	SRR8316904	Silver flowering stage	29.866
	SRR8316905	Silver flowering stage	32.555
	SRR8316906	Gold flowering stage	0.167
	SRR8316907	Gold flowering stage	0.226
	SRR8316908	Gold flowering stage	0.335
SRP132670	SRR6706286	Control	1.953
	SRR6706287	Light intensity 50%	3.998
	SRR6706288	Light intensity 20%	2.526
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	17.599
	CNS0095593	Slightly white alabastrum(diploid) 2	12.917
	CNS0095594	Slightly white alabastrum(diploid) 3	14.793
	CNS0095595	Whole white alabastrum(diploid) 2	27.802
	CNS0095596	Whole white alabastrum(diploid) 3	17.366
	CNS0095597	Whole white alabastrum(diploid) 4	30.648
	CNS0095598	Silvery flower (diploied) 1	18.374
	CNS0095599	Silvery flower (diploied) 2	18.877
	CNS0095600	Silvery flower (diploied) 3	7.405
	CNS0095601	Golden flower (diploid) 1	19.233
	CNS0095602	Golden flower (diploid) 2	6.538
	CNS0095603	Golden flower (diploid) 3	11.460
	CNS0095604	Slightly white alabastrum(tetraploid) 1	16.283
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.082
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.483
	CNS0095607	Whole white alabastrum(tetraploid) 1	23.957
	CNS0095608	Whole white alabastrum(tetraploid) 2	25.872
	CNS0095609	Whole white alabastrum(tetraploid) 3	11.354
	CNS0095610	Silvery flower (tetraploid) 1	4.286
	CNS0095611	Silvery flower (tetraploid) 2	5.763
	CNS0095612	Silvery flower (tetraploid) 3	2.290
	CNS0095613	Golden flower (tetraploid) 1	21.576
	CNS0095614	Golden flower (tetraploid) 2	7.182
	CNS0095615	Golden flower (tetraploid) 3	3.557
CRA001975	CRR073297	Stem 1	10.231
	CRR073298	Stem 2	7.476
	CRR073299	Stem 3	1.305
	CRR073300	Leaf 1	3.023
	CRR073301	Leaf 2	4.317
	CRR073302	Leaf 3	2.304
	CRR073303	Juvenile bud 1	5.180
	CRR073304	Juvenile bud 2	2.472
	CRR073305	Juvenile bud 3	8.226
	CRR073306	Third green 1	5.128
	CRR073307	Third green 2	1.883
	CRR073308	Third green 3	4.347
	CRR073309	Second white 1	1.681
	CRR073310	Second white 2	10.368
	CRR073311	Second white 3	28.639
	CRR073312	Silver flowering 1	15.109
	CRR073313	Silver flowering 2	3.120
	CRR073314	Silver flowering 3	7.501
	CRR073315	Gold flowering 1	2.411
	CRR073316	Gold flowering 2	2.287
	CRR073317	Gold flowering 3	3.928
	CRR073318	Tawny withering 1	2.077
	CRR073319	Tawny withering 2	3.438
	CRR073320	Tawny withering 3	1.576