Gene detail

Detail information of GWHGAAZE010055

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_009091713.1	3.0299E-121	NADH dehydrogenase subunit 9 (mitochondrion) [Panax ginseng]
Swissprot	tr\|Q95748\|NDUS3_ARATH	9E-113	NADH dehydrogenase [ubiquinone] iron-sulfur protein 3
trEMBL	tr\|A0A096XF79\|A0A096XF79_PANGI	1E-121	NADH dehydrogenase subunit 9 {ECO:0000313\|EMBL:AHJ80999.1}
TAIR10	ATMG00070.1	2E-93	NADH dehydrogenase subunit 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	122764290	122764799	+
GWHAAZE00000002	mRNA	122764290	122764799	+
GWHAAZE00000002	exon	122764290	122764799	+
GWHAAZE00000002	CDS	122764290	122764799	+

Transcript Sequence
>GWHTAAZE010067 ATGGAAAGATCGGAACATGGGAATAGATCTGATACCAATACGGACTACCCATTTCAATTGTTGTGCTTTCTGAAATTGCATACCTATACAAGGGTTCAAGTTTCGATCGATATTTGCGGAGTTGATCATCCCTCTCGAAAACGAAGATTTGAAGTGGTCTATAATTTACTGAGTACTCGGTATAACTCACGCATTCGTGTACAAACCAGTGCAGACGAAGTAACACGAATATCTCCGGTAGTCAGTCCATTTCCATCAGCCGGCCGGTGGGAGCGAGAAGTTTGGGATATGTTTGGTGTTTCTTCCATCAATCATCCGGATCTACGCCGTATATCAACAGATTATGGTTTCGAGGGTCATCCATTACGAAAAGACCTTCCTCTGAGTGGATATGTGGAAGTACGCTATGATGATCCAGAGAAACGTGTGGTTTCTGAACCCATTGAGATGACCCAAGAATTTCGCTATTTCGATTCTGCTAGTCCTTGGGAACAGCGTAGCGACGGATAA

Network for GWHGAAZE010055

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00329.20	Complex1_30kDa	20	131	1.10E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03936	NDUFS3	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Retrograde endocannabinoid signaling	map04723
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0008137	molecular_function	NADH dehydrogenase (ubiquinone) activity
GO:0016651	molecular_function	oxidoreductase activity, acting on NAD(P)H

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.249
	SRR3591706	second leaf	0.047
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.452
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.076
	SRR3591711	White flower	0.178
	SRR3591712	Green floral bud	0.224
	SRR3591713	Yellow flower	0.245
SRP173429	SRR8316895	Juvenile bud stage	6.640
	SRR8316896	Juvenile bud stage	3.114
	SRR8316897	Juvenile bud stage	15.373
	SRR8316894	Third green stage	12.031
	SRR8316900	Third green stage	1.205
	SRR8316901	Third green stage	1.377
	SRR8316898	Complete white stage	7.668
	SRR8316899	Complete white stage	0.238
	SRR8316903	Complete white stage	8.519
	SRR8316902	Silver flowering stage	12.891
	SRR8316904	Silver flowering stage	11.693
	SRR8316905	Silver flowering stage	10.921
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.069
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.232
	SRR6706287	Light intensity 50%	0.201
	SRR6706288	Light intensity 20%	0.394
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.411
	CNS0095593	Slightly white alabastrum(diploid) 2	4.103
	CNS0095594	Slightly white alabastrum(diploid) 3	4.537
	CNS0095595	Whole white alabastrum(diploid) 2	6.237
	CNS0095596	Whole white alabastrum(diploid) 3	4.730
	CNS0095597	Whole white alabastrum(diploid) 4	9.037
	CNS0095598	Silvery flower (diploied) 1	7.883
	CNS0095599	Silvery flower (diploied) 2	3.669
	CNS0095600	Silvery flower (diploied) 3	0.948
	CNS0095601	Golden flower (diploid) 1	5.843
	CNS0095602	Golden flower (diploid) 2	0.378
	CNS0095603	Golden flower (diploid) 3	0.769
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.733
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.250
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.943
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.673
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.270
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.670
	CNS0095610	Silvery flower (tetraploid) 1	1.021
	CNS0095611	Silvery flower (tetraploid) 2	0.470
	CNS0095612	Silvery flower (tetraploid) 3	0.550
	CNS0095613	Golden flower (tetraploid) 1	4.161
	CNS0095614	Golden flower (tetraploid) 2	0.760
	CNS0095615	Golden flower (tetraploid) 3	0.068
CRA001975	CRR073297	Stem 1	1.874
	CRR073298	Stem 2	0.362
	CRR073299	Stem 3	0.082
	CRR073300	Leaf 1	0.200
	CRR073301	Leaf 2	0.664
	CRR073302	Leaf 3	0.238
	CRR073303	Juvenile bud 1	1.892
	CRR073304	Juvenile bud 2	1.149
	CRR073305	Juvenile bud 3	2.120
	CRR073306	Third green 1	0.834
	CRR073307	Third green 2	0.442
	CRR073308	Third green 3	0.805
	CRR073309	Second white 1	0.211
	CRR073310	Second white 2	2.779
	CRR073311	Second white 3	11.367
	CRR073312	Silver flowering 1	4.647
	CRR073313	Silver flowering 2	0.958
	CRR073314	Silver flowering 3	3.524
	CRR073315	Gold flowering 1	0.832
	CRR073316	Gold flowering 2	0.555
	CRR073317	Gold flowering 3	1.536
	CRR073318	Tawny withering 1	0.046
	CRR073319	Tawny withering 2	0.446
	CRR073320	Tawny withering 3	0.146