Gene detail

Detail information of GWHGAAZE010062

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_006291798.1	1.06905E-90	nad4 gene product (mitochondrion) [Daucus carota subsp. sativus]
Swissprot	tr\|Q04050\|NU4M_BRACM	3E-86	NADH-ubiquinone oxidoreductase chain 4
trEMBL	tr\|K4AQA8\|K4AQA8_SOLLC	9E-93	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc00g013180.1.1}
TAIR10	ATMG00580.1	1E-72	NADH dehydrogenase subunit 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	122835988	122836622	-
GWHAAZE00000002	mRNA	122835988	122836622	-
GWHAAZE00000002	exon	122836619	122836622	-
GWHAAZE00000002	exon	122835988	122836451	-
GWHAAZE00000002	CDS	122836619	122836622	-
GWHAAZE00000002	CDS	122835988	122836451	-

Transcript Sequence
>GWHTAAZE010074 ATGGTGGGGGGGGAATCTTTGGCTCTATCGAACATACAGGGAATTGGAGGTAGCATTCCACCGATGTCAAGTCATGGACTGGTTCCTTCAGCCCTTTTTCTATGTGTTGGTGTTCTATATGACCGACATAAGACTCGACTTGTTAGATATTACGGAGGTTCAGTGAGCACCATGCCGAATCTCTCTACCATTTTCTTCTCTTCCACTTTGGCCAATATGAGTTCACCTGGTACTAGCAGCTTTATCGGGGAATTTCTCATCTTAGTAGGAGCTTTCCAAAGAAATAGCTTAGTAGCCACATTAGCAGCGCTTGGGATGATTTTAGGCGCGGCGTATTCCCTTTGGCTATATAATCGTGCGGTTTCTGGGAATTTAAAACCTGATTTCCTCCATAAATTCTCCGATCCAAATGGCAGAGAAGTTTCCATATTTATACCTTTTCTTGTTGGAGGGGCGACCGTCCGTTAA

Network for GWHGAAZE010062

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00361.21	Proton_antipo_M	8	106	4.40E-16

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03881	ND4	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Retrograde endocannabinoid signaling	map04723
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0042773	biological_process	ATP synthesis coupled electron transport
GO:0055114	biological_process	oxidation-reduction process
GO:0008137	molecular_function	NADH dehydrogenase (ubiquinone) activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.067
	SRR3591706	second leaf	0.151
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	1.114
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.255
	SRR3591711	White flower	0.356
	SRR3591712	Green floral bud	0.364
	SRR3591713	Yellow flower	0.199
SRP173429	SRR8316895	Juvenile bud stage	7.918
	SRR8316896	Juvenile bud stage	4.123
	SRR8316897	Juvenile bud stage	14.872
	SRR8316894	Third green stage	12.286
	SRR8316900	Third green stage	0.820
	SRR8316901	Third green stage	0.959
	SRR8316898	Complete white stage	4.598
	SRR8316899	Complete white stage	0.183
	SRR8316903	Complete white stage	5.462
	SRR8316902	Silver flowering stage	9.563
	SRR8316904	Silver flowering stage	8.041
	SRR8316905	Silver flowering stage	6.914
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.050
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.206
	SRR6706287	Light intensity 50%	0.494
	SRR6706288	Light intensity 20%	0.156
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.522
	CNS0095593	Slightly white alabastrum(diploid) 2	2.385
	CNS0095594	Slightly white alabastrum(diploid) 3	3.603
	CNS0095595	Whole white alabastrum(diploid) 2	5.952
	CNS0095596	Whole white alabastrum(diploid) 3	3.405
	CNS0095597	Whole white alabastrum(diploid) 4	5.013
	CNS0095598	Silvery flower (diploied) 1	4.637
	CNS0095599	Silvery flower (diploied) 2	2.557
	CNS0095600	Silvery flower (diploied) 3	1.671
	CNS0095601	Golden flower (diploid) 1	2.774
	CNS0095602	Golden flower (diploid) 2	0.892
	CNS0095603	Golden flower (diploid) 3	1.963
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.290
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.451
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.416
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.110
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.791
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.409
	CNS0095610	Silvery flower (tetraploid) 1	0.699
	CNS0095611	Silvery flower (tetraploid) 2	0.857
	CNS0095612	Silvery flower (tetraploid) 3	1.118
	CNS0095613	Golden flower (tetraploid) 1	3.035
	CNS0095614	Golden flower (tetraploid) 2	2.158
	CNS0095615	Golden flower (tetraploid) 3	0.653
CRA001975	CRR073297	Stem 1	0.953
	CRR073298	Stem 2	1.022
	CRR073299	Stem 3	0.046
	CRR073300	Leaf 1	0.263
	CRR073301	Leaf 2	0.332
	CRR073302	Leaf 3	0.351
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.933
	CRR073306	Third green 1	0.270
	CRR073307	Third green 2	0.143
	CRR073308	Third green 3	0.609
	CRR073309	Second white 1	0.643
	CRR073310	Second white 2	2.001
	CRR073311	Second white 3	3.979
	CRR073312	Silver flowering 1	3.651
	CRR073313	Silver flowering 2	1.556
	CRR073314	Silver flowering 3	0.747
	CRR073315	Gold flowering 1	0.141
	CRR073316	Gold flowering 2	0.071
	CRR073317	Gold flowering 3	1.019
	CRR073318	Tawny withering 1	0.454
	CRR073319	Tawny withering 2	0.321
	CRR073320	Tawny withering 3	0.279