Gene detail

Detail information of GWHGAAZE010066

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AII18854.1	1.48181E-61	NADH-plastoquinone oxidoreductase subunit 1, partial (chloroplast) [Viburnum plicatum]
Swissprot	tr\|Q0G9Q7\|NU1C_DAUCA	1E-61	NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01350}
trEMBL	tr\|A0A076FMT6\|A0A076FMT6_9DIPS	6E-62	NADH-plastoquinone oxidoreductase subunit 1 {ECO:0000313\|EMBL:AII18854.1} (Fragment)
TAIR10	ATCG01100.1	1E-35	NADH dehydrogenase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	122889155	122889484	-
GWHAAZE00000002	mRNA	122889155	122889484	-
GWHAAZE00000002	exon	122889155	122889484	-
GWHAAZE00000002	CDS	122889155	122889484	-

Transcript Sequence
>GWHTAAZE010078 ATGATAATTGATACAACAGAAGTACAAGCTATCAATTCTTTTTCCAGATTGGAATCGTTAAAAGAGGTCTATGAGATCATATGGATGCTTGTCCCTATTTTGACTCTTGTATTAGGAATCACAATAGGTGTACTAGTCATTGTTTGGTTAGAAAGAGAAAGATCCGCAGGAATACAACAACGTATTGGACCTGAATACGCTGGCCCTTGGGGAATTCTTCAAGCTCTAGCAGATGGGAAAAAATGCGTTTTCAAAGATAATCTTCTTCCATCTAGAGGAGATACTCGTTTATTCAGTATCGGACCATCCATAGCAGTTATATCCATTTGA

Network for GWHGAAZE010066

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00146.22	NADHdh	33	108	7.90E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05572	ndhA	Metabolic pathways	map01100
K05572	ndhA	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016020	cellular_component	membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.002
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.458
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.108
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.356
	SRR8316904	Silver flowering stage	0.227
	SRR8316905	Silver flowering stage	0.282
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.538
	CNS0095593	Slightly white alabastrum(diploid) 2	0.432
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	1.508
	CNS0095596	Whole white alabastrum(diploid) 3	0.151
	CNS0095597	Whole white alabastrum(diploid) 4	0.234
	CNS0095598	Silvery flower (diploied) 1	0.283
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.071
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.056
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.134
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.657
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.056
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.168
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.255
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.324
	CNS0095611	Silvery flower (tetraploid) 2	0.055
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.193
	CNS0095614	Golden flower (tetraploid) 2	0.453
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.228
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.023
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.336
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.001
	CRR073311	Second white 3	0.896
	CRR073312	Silver flowering 1	0.689
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.174
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000