Gene detail

Detail information of GWHGAAZE010099

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AII17759.1	3.80847E-83	ribosomal protein L22, partial (chloroplast) [Viburnum opulus]
Swissprot	tr\|Q332T7\|RK22_LACSA	1E-77	50S ribosomal protein L22, chloroplastic
trEMBL	tr\|A0A076FJJ5\|A0A076FJJ5_VIBOP	1E-83	50S ribosomal protein L22, chloroplastic {ECO:0000256\|RuleBase:RU004009} (Fragment)
TAIR10	ATCG00810.1	3E-46	ribosomal protein L22

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123402099	123402632	+
GWHAAZE00000002	mRNA	123402099	123402632	+
GWHAAZE00000002	exon	123402099	123402632	+
GWHAAZE00000002	CDS	123402099	123402632	+

Transcript Sequence
>GWHTAAZE010111 ATGTCTGCTCACAAAGCGCGAAGAGTAATTGATGAAATTCGTGGGCGTTCCTACGAAGAAACACTTATGATACTAGAACTCATGCCTTATCGAGCATGTTATCCCATTTTGAAATGGGTTTCTTCTGCAGCAGCAAATGCTAGTTACAATATGGGTTCCAACGAAGCTAATTTAATCATTAGTAAAGCTGAAGTCAACGAGGGTACTCCCGTGAAGAAATTCAAACCTCGAGCTCGAGGACGTAGTTATCCGATAAAAAGACCTACCTGCCATATAACTATTGTAGTGAAAGATATGTCCTTAACTGAATATATAGAGATAGACTATCTTACATGGTCAAAAAAACCTAAATGGAAAAAATGGAAAAAGAAGTATACAGATGTGGCGTATCATCCTATGTATAGTAATGGGGGAGTATGGGACAAAAAAGAAATCCACTTGGTTTCAGACTTGGTACAACCCAAGGTCATCATTCCCTTTGGTTTGCACCACCAAAAAAAGATTCCGAAGGTCTACAAGAAGATAAAAAAATAA

Network for GWHGAAZE010099

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00237.20	Ribosomal_L22	1	97	8.30E-26

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02890	RP-L22, MRPL22, rplV	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0015934	cellular_component	large ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.037
	SRR3591707	mature leaf	0.262
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.187
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.484
	SRR8316896	Juvenile bud stage	0.797
	SRR8316897	Juvenile bud stage	0.153
	SRR8316894	Third green stage	0.601
	SRR8316900	Third green stage	0.503
	SRR8316901	Third green stage	0.439
	SRR8316898	Complete white stage	0.236
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.346
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.130
	SRR8316905	Silver flowering stage	0.311
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.022
	SRR8316908	Gold flowering stage	0.058
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.078
	CNS0095593	Slightly white alabastrum(diploid) 2	0.141
	CNS0095594	Slightly white alabastrum(diploid) 3	1.008
	CNS0095595	Whole white alabastrum(diploid) 2	0.826
	CNS0095596	Whole white alabastrum(diploid) 3	0.782
	CNS0095597	Whole white alabastrum(diploid) 4	0.604
	CNS0095598	Silvery flower (diploied) 1	1.026
	CNS0095599	Silvery flower (diploied) 2	0.714
	CNS0095600	Silvery flower (diploied) 3	0.186
	CNS0095601	Golden flower (diploid) 1	0.133
	CNS0095602	Golden flower (diploid) 2	0.350
	CNS0095603	Golden flower (diploid) 3	0.218
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.369
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.093
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.282
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.641
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.032
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.305
	CNS0095612	Silvery flower (tetraploid) 3	0.036
	CNS0095613	Golden flower (tetraploid) 1	0.382
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.156
CRA001975	CRR073297	Stem 1	0.202
	CRR073298	Stem 2	0.156
	CRR073299	Stem 3	0.053
	CRR073300	Leaf 1	0.072
	CRR073301	Leaf 2	0.172
	CRR073302	Leaf 3	0.036
	CRR073303	Juvenile bud 1	0.048
	CRR073304	Juvenile bud 2	0.145
	CRR073305	Juvenile bud 3	0.357
	CRR073306	Third green 1	0.119
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.190
	CRR073309	Second white 1	0.032
	CRR073310	Second white 2	0.252
	CRR073311	Second white 3	0.918
	CRR073312	Silver flowering 1	0.729
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.304
	CRR073315	Gold flowering 1	0.849
	CRR073316	Gold flowering 2	0.339
	CRR073317	Gold flowering 3	0.268
	CRR073318	Tawny withering 1	0.392
	CRR073319	Tawny withering 2	0.542
	CRR073320	Tawny withering 3	0.004