Gene detail

Detail information of GWHGAAZE010105

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ACA30556.1	3.54195E-47	photosystem II P680 chlorophyll A apoprotein, partial (chloroplast) [Oenothera elata subsp. elata]
Swissprot	tr\|Q06FP2\|PSBB_PELHO	5E-47	Photosystem II CP47 reaction center protein {ECO:0000255\|HAMAP-Rule:MF_01495}
trEMBL	tr\|B1PLN7\|B1PLN7_9MYRT	1E-47	Photosystem II P680 chlorophyll A apoprotein {ECO:0000313\|EMBL:ACA30556.1} (Fragment)
TAIR10	ATCG00680.1	2E-39	photosystem II reaction center protein B

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123527556	123527795	-
GWHAAZE00000002	mRNA	123527556	123527795	-
GWHAAZE00000002	exon	123527556	123527795	-
GWHAAZE00000002	CDS	123527556	123527795	-

Transcript Sequence
>GWHTAAZE010117 ATGGGTTTGCCTTGGTATCGTGTTCATACCGTTGTATTGAATGATCCCGGTCGACTGCTTTCTGTCCATATAATGCATACAGCTCTGGTTGCGGGTTGGGCCGGTTCTATGGCTCTGTATGAATTAGCAGTTTTTGATCCCTCTGACCCCGTTCTTGATCCAATGTGGAGACAGGGTATGTTCGTTATACCATTCATGACTCGTTTAGGAATAACCAATTCATGGGGTTGGTTGGGGTAA

Network for GWHGAAZE010105

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00421.20	PSII	1	76	4.60E-44

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02704	psbB	Metabolic pathways	map01100
K02704	psbB	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0009767	biological_process	photosynthetic electron transport chain
GO:0019684	biological_process	photosynthesis, light reaction
GO:0009521	cellular_component	photosystem
GO:0016020	cellular_component	membrane
GO:0016168	molecular_function	chlorophyll binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.308
	SRR3591706	second leaf	0.407
	SRR3591707	mature leaf	0.599
	SRR3591708	Shoot apex	0.387
	SRR3591709	Stem	0.143
	SRR3591710	White floral bud	0.195
	SRR3591711	White flower	0.078
	SRR3591712	Green floral bud	0.238
	SRR3591713	Yellow flower	0.297
SRP173429	SRR8316895	Juvenile bud stage	4.660
	SRR8316896	Juvenile bud stage	1.182
	SRR8316897	Juvenile bud stage	4.206
	SRR8316894	Third green stage	5.593
	SRR8316900	Third green stage	0.074
	SRR8316901	Third green stage	0.278
	SRR8316898	Complete white stage	1.446
	SRR8316899	Complete white stage	0.072
	SRR8316903	Complete white stage	1.311
	SRR8316902	Silver flowering stage	1.371
	SRR8316904	Silver flowering stage	1.888
	SRR8316905	Silver flowering stage	1.433
	SRR8316906	Gold flowering stage	0.067
	SRR8316907	Gold flowering stage	0.127
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.078
	SRR6706287	Light intensity 50%	0.119
	SRR6706288	Light intensity 20%	0.096
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.961
	CNS0095593	Slightly white alabastrum(diploid) 2	1.224
	CNS0095594	Slightly white alabastrum(diploid) 3	1.931
	CNS0095595	Whole white alabastrum(diploid) 2	2.446
	CNS0095596	Whole white alabastrum(diploid) 3	1.160
	CNS0095597	Whole white alabastrum(diploid) 4	1.161
	CNS0095598	Silvery flower (diploied) 1	0.822
	CNS0095599	Silvery flower (diploied) 2	1.246
	CNS0095600	Silvery flower (diploied) 3	0.365
	CNS0095601	Golden flower (diploid) 1	1.248
	CNS0095602	Golden flower (diploid) 2	0.396
	CNS0095603	Golden flower (diploid) 3	0.696
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.470
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.828
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.841
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.762
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.998
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.527
	CNS0095610	Silvery flower (tetraploid) 1	0.709
	CNS0095611	Silvery flower (tetraploid) 2	0.606
	CNS0095612	Silvery flower (tetraploid) 3	0.854
	CNS0095613	Golden flower (tetraploid) 1	1.533
	CNS0095614	Golden flower (tetraploid) 2	0.405
	CNS0095615	Golden flower (tetraploid) 3	0.204
CRA001975	CRR073297	Stem 1	1.285
	CRR073298	Stem 2	1.481
	CRR073299	Stem 3	0.211
	CRR073300	Leaf 1	0.790
	CRR073301	Leaf 2	0.981
	CRR073302	Leaf 3	0.575
	CRR073303	Juvenile bud 1	0.829
	CRR073304	Juvenile bud 2	0.428
	CRR073305	Juvenile bud 3	1.555
	CRR073306	Third green 1	0.250
	CRR073307	Third green 2	0.487
	CRR073308	Third green 3	1.434
	CRR073309	Second white 1	0.765
	CRR073310	Second white 2	1.857
	CRR073311	Second white 3	1.826
	CRR073312	Silver flowering 1	1.663
	CRR073313	Silver flowering 2	0.279
	CRR073314	Silver flowering 3	2.095
	CRR073315	Gold flowering 1	7.967
	CRR073316	Gold flowering 2	5.449
	CRR073317	Gold flowering 3	16.861
	CRR073318	Tawny withering 1	0.899
	CRR073319	Tawny withering 2	0.214
	CRR073320	Tawny withering 3	0.262