Gene detail

Detail information of GWHGAAZE010108

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KEH15194.1	0	ATP synthase, F1 beta subunit [Medicago truncatula]
Swissprot	tr\|Q8MBM3\|ATPB_CONAR	6E-124	ATP synthase subunit beta, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01347}
trEMBL	tr\|A0A072TC88\|A0A072TC88_MEDTR	0	ATP synthase, F1 beta subunit {ECO:0000313\|EMBL:KEH15194.1}
TAIR10	ATCG00480.1	3E-100	ATP synthase subunit beta

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123571921	123572942	+
GWHAAZE00000002	mRNA	123571921	123572942	+
GWHAAZE00000002	exon	123571921	123572479	+
GWHAAZE00000002	exon	123572593	123572942	+
GWHAAZE00000002	CDS	123571921	123572479	+
GWHAAZE00000002	CDS	123572593	123572942	+

Transcript Sequence
>GWHTAAZE010120 ATGCCTTCCGCTGTGGGTTATCAACCTACCCTTAGTACCGAAATGGGTACTTTACAAGAAAGAATTACTTCTACCAAGAAGGGGTCCATAACTTCTATTCAAGCGGTTTATGTCCCTGCAGACGATTTGACCGACCCTGCTCCTGCTACGACATTTGCACATTTAGATGCTACTACCGTACTATCAAGAGGATTGGCCGCCAAGGGTATCTATCCAGCAGTAGATCCTTTAGATTCAACGTCAACTATGCTACAACCTGGGATCGTTGGTAAGAACCATTATGAAACAGCGCAAAGGGTTAAGGAAACTTTACAACGTTACAAAGAACTTCAGGACATTATAGCTATCCTTGGGTTGGACGAATTATCCGAAGAGGATCGTTTAACCGTAGCAAGAGCACGAAAAATTGAGCGTTTCTTATCACAACCTTTTTTTGTAGCAGAAGTATTTACCGGTTCTCCAGGGAAATATGTTGGTCTAACAGAAACAATTAGAGGGTTTCAATTGATCCTTTCCGGAGAATTAGATGTTCTTCCCGAACAGGCCTTTTATTTGGTAGAAGTGAAAGAAAGAATTTTATCTACTAATAGTGGCCAAATTGGCGTATTACCAAATCACGCCCCTATTGCCACAGCTGTCGATATAGGTATTTTGAGAATACGCCTTAACGACCAATGGGTAACGATGGCTCTGATGGGTGGTTTTGCTAGAATAGGTAATAATGAGATCACTGTTTTAGTAAATAATGCGGAAAAGAGTAGTGACATTGATCCACACGAAGCTCAGCAAACTCTTGAAATAGCGGAAGCTGGTTTGAGAAAAGCTGAAGGAAAAAGACAAACAATTGAGGCAAATCTAGCCCTCCGACGAGCTAGGACACGAGTAGAGACTATCAGGGCGATTTCATAA

Network for GWHGAAZE010108

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00006.26	ATP-synt_ab	1	81	2.80E-20
PF02823.17	ATP-synt_DE_N	177	250	4.40E-19
PF00401.21	ATP-synt_DE	255	297	3.10E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02112	ATPF1B, atpD	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0045261	cellular_component	proton-transporting ATP synthase complex, catalytic core F(1)
GO:0046933	molecular_function	proton-transporting ATP synthase activity, rotational mechanism
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.035
	SRR3591706	second leaf	0.449
	SRR3591707	mature leaf	0.544
	SRR3591708	Shoot apex	0.319
	SRR3591709	Stem	0.167
	SRR3591710	White floral bud	0.071
	SRR3591711	White flower	0.035
	SRR3591712	Green floral bud	0.121
	SRR3591713	Yellow flower	0.211
SRP173429	SRR8316895	Juvenile bud stage	3.087
	SRR8316896	Juvenile bud stage	0.952
	SRR8316897	Juvenile bud stage	4.183
	SRR8316894	Third green stage	3.556
	SRR8316900	Third green stage	0.472
	SRR8316901	Third green stage	0.325
	SRR8316898	Complete white stage	1.136
	SRR8316899	Complete white stage	0.095
	SRR8316903	Complete white stage	0.653
	SRR8316902	Silver flowering stage	1.198
	SRR8316904	Silver flowering stage	1.366
	SRR8316905	Silver flowering stage	1.081
	SRR8316906	Gold flowering stage	0.133
	SRR8316907	Gold flowering stage	0.112
	SRR8316908	Gold flowering stage	0.227
SRP132670	SRR6706286	Control	0.022
	SRR6706287	Light intensity 50%	0.072
	SRR6706288	Light intensity 20%	0.049
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.708
	CNS0095593	Slightly white alabastrum(diploid) 2	0.666
	CNS0095594	Slightly white alabastrum(diploid) 3	1.457
	CNS0095595	Whole white alabastrum(diploid) 2	1.073
	CNS0095596	Whole white alabastrum(diploid) 3	0.820
	CNS0095597	Whole white alabastrum(diploid) 4	0.959
	CNS0095598	Silvery flower (diploied) 1	0.602
	CNS0095599	Silvery flower (diploied) 2	0.758
	CNS0095600	Silvery flower (diploied) 3	0.448
	CNS0095601	Golden flower (diploid) 1	0.605
	CNS0095602	Golden flower (diploid) 2	0.362
	CNS0095603	Golden flower (diploid) 3	0.538
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.198
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.550
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.606
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.911
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.866
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.480
	CNS0095610	Silvery flower (tetraploid) 1	0.255
	CNS0095611	Silvery flower (tetraploid) 2	0.537
	CNS0095612	Silvery flower (tetraploid) 3	0.173
	CNS0095613	Golden flower (tetraploid) 1	0.569
	CNS0095614	Golden flower (tetraploid) 2	0.235
	CNS0095615	Golden flower (tetraploid) 3	0.356
CRA001975	CRR073297	Stem 1	2.494
	CRR073298	Stem 2	2.963
	CRR073299	Stem 3	1.181
	CRR073300	Leaf 1	1.413
	CRR073301	Leaf 2	1.592
	CRR073302	Leaf 3	0.819
	CRR073303	Juvenile bud 1	1.042
	CRR073304	Juvenile bud 2	1.084
	CRR073305	Juvenile bud 3	1.974
	CRR073306	Third green 1	1.317
	CRR073307	Third green 2	0.712
	CRR073308	Third green 3	1.450
	CRR073309	Second white 1	1.722
	CRR073310	Second white 2	2.687
	CRR073311	Second white 3	4.008
	CRR073312	Silver flowering 1	3.552
	CRR073313	Silver flowering 2	0.852
	CRR073314	Silver flowering 3	0.901
	CRR073315	Gold flowering 1	17.974
	CRR073316	Gold flowering 2	16.038
	CRR073317	Gold flowering 3	27.571
	CRR073318	Tawny withering 1	1.263
	CRR073319	Tawny withering 2	0.957
	CRR073320	Tawny withering 3	0.979