Gene detail

Detail information of GWHGAAZE010114

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ABK96736.1	3.49679E-58	unknown [Populus trichocarpa x Populus deltoides]
Swissprot	tr\|A4QKR6\|ATPA_CRUWA	2E-58	ATP synthase subunit alpha, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01346}
trEMBL	tr\|A9PK33\|A9PK33_9ROSI	1E-58	Putative uncharacterized protein {ECO:0000313\|EMBL:ABK96736.1}
TAIR10	ATCG00120.1	3E-49	ATP synthase subunit alpha

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123684674	123684982	-
GWHAAZE00000002	mRNA	123684674	123684982	-
GWHAAZE00000002	exon	123684674	123684982	-
GWHAAZE00000002	CDS	123684674	123684982	-

Transcript Sequence
>GWHTAAZE010126 ATGTCTCTTCTATTACGAAGACCACCCGGCCGCGAAGCTTATCCAGGGGATGTTTTTTATTTACATTCACGCCTTTTGGAAAGAGCTGCTAAATTAAGTTCTCAGTTAGGTGAAGGAAGTATGACTGCTTTACCAATAGTCGAAACTCAATCGGGAGATGTTTCGGCTTATATTCCGACTAATGTTATTTCGATTACTGATGGACAAATATTCTTATCCGCCGACCTATTCAATGCTGGAATCAGACCCGCTATTAATGTCGGTCTCTCCGTTTCAGAGTTGGATCTGCGGCTCAAATTAAAGCCATGA

Network for GWHGAAZE010114

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00006.26	ATP-synt_ab	1	92	1.70E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02111	ATPF1A, atpA	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.123
	SRR3591706	second leaf	10.543
	SRR3591707	mature leaf	8.487
	SRR3591708	Shoot apex	4.849
	SRR3591709	Stem	1.474
	SRR3591710	White floral bud	0.688
	SRR3591711	White flower	1.085
	SRR3591712	Green floral bud	1.711
	SRR3591713	Yellow flower	1.285
SRP173429	SRR8316895	Juvenile bud stage	9.384
	SRR8316896	Juvenile bud stage	4.652
	SRR8316897	Juvenile bud stage	9.920
	SRR8316894	Third green stage	12.679
	SRR8316900	Third green stage	1.894
	SRR8316901	Third green stage	1.884
	SRR8316898	Complete white stage	3.326
	SRR8316899	Complete white stage	1.091
	SRR8316903	Complete white stage	2.929
	SRR8316902	Silver flowering stage	6.106
	SRR8316904	Silver flowering stage	7.454
	SRR8316905	Silver flowering stage	5.682
	SRR8316906	Gold flowering stage	1.507
	SRR8316907	Gold flowering stage	0.703
	SRR8316908	Gold flowering stage	0.834
SRP132670	SRR6706286	Control	0.512
	SRR6706287	Light intensity 50%	0.801
	SRR6706288	Light intensity 20%	0.628
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.173
	CNS0095593	Slightly white alabastrum(diploid) 2	0.925
	CNS0095594	Slightly white alabastrum(diploid) 3	2.666
	CNS0095595	Whole white alabastrum(diploid) 2	3.231
	CNS0095596	Whole white alabastrum(diploid) 3	2.760
	CNS0095597	Whole white alabastrum(diploid) 4	3.446
	CNS0095598	Silvery flower (diploied) 1	4.246
	CNS0095599	Silvery flower (diploied) 2	1.668
	CNS0095600	Silvery flower (diploied) 3	2.098
	CNS0095601	Golden flower (diploid) 1	1.444
	CNS0095602	Golden flower (diploid) 2	2.220
	CNS0095603	Golden flower (diploid) 3	2.693
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.568
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.554
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.165
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.646
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.724
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.675
	CNS0095610	Silvery flower (tetraploid) 1	1.353
	CNS0095611	Silvery flower (tetraploid) 2	1.553
	CNS0095612	Silvery flower (tetraploid) 3	2.282
	CNS0095613	Golden flower (tetraploid) 1	2.798
	CNS0095614	Golden flower (tetraploid) 2	2.438
	CNS0095615	Golden flower (tetraploid) 3	2.319
CRA001975	CRR073297	Stem 1	4.073
	CRR073298	Stem 2	2.711
	CRR073299	Stem 3	1.556
	CRR073300	Leaf 1	1.577
	CRR073301	Leaf 2	1.166
	CRR073302	Leaf 3	0.706
	CRR073303	Juvenile bud 1	1.762
	CRR073304	Juvenile bud 2	1.635
	CRR073305	Juvenile bud 3	2.685
	CRR073306	Third green 1	1.347
	CRR073307	Third green 2	0.528
	CRR073308	Third green 3	2.251
	CRR073309	Second white 1	4.643
	CRR073310	Second white 2	6.966
	CRR073311	Second white 3	14.715
	CRR073312	Silver flowering 1	12.943
	CRR073313	Silver flowering 2	3.957
	CRR073314	Silver flowering 3	3.631
	CRR073315	Gold flowering 1	14.549
	CRR073316	Gold flowering 2	21.399
	CRR073317	Gold flowering 3	18.772
	CRR073318	Tawny withering 1	1.884
	CRR073319	Tawny withering 2	1.200
	CRR073320	Tawny withering 3	0.585