Gene detail

Detail information of GWHGAAZE010123

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD29919.1	5.6691E-140	ribosomal protein S4 (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q68S04\|RR4_PANGI	1E-125	30S ribosomal protein S4, chloroplastic
trEMBL	tr\|D3WBU7\|D3WBU7_LONJA	2E-140	30S ribosomal protein S4, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01306}
TAIR10	ATCG00380.1	7E-91	chloroplast ribosomal protein S4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123720441	123721034	-
GWHAAZE00000002	mRNA	123720441	123721034	-
GWHAAZE00000002	exon	123720441	123721034	-
GWHAAZE00000002	CDS	123720441	123721034	-

Transcript Sequence
>GWHTAAZE010135 ATGTCGCGTTACCGAGGACCTCGTTTTAAAAAAATACGCCGCCTGGGGGCTTTGCCGGGACTAACTAAAAAGGGGCCTATAGGTCAATCGCGTTCCGTGAAAAAATCTCAATATCGTATTCGCCTTGAAGAAAAACAAAAATTGCGTTTTCATTATGGTCTTACAGAACGGCAATTACTTAAATATGTTCGTATCGCCGGAAAAGCCAAGGGGTCAACAGGTCAGGTTTTACTACAATTACTTGAAATGCGATTGGATAACATCCTTTTTCGATTGGGTATGGCTCCGACTATTCCCGGAGCTCGCCAATTAGTTAACCATAGACATATTTTAGTCAACGGCCGTATCGTAGATATACCAAGTTATCGCTGCAAACCCCGAGATATTATTACGGCGCGGGATGAACAAAACTCTAGAGCTCTGATTCAAAATTCTCTCAATTCATCCCCTCATAAGAAAAATAAATTGCCAAAACATTTGACTCTTCAGCCATTCCAATATAAAGGATTAGTCAATCAAATAATAGATAGTAAATGGGTCGGTTTGAAAATAAATGAATTGCTAGTCGTAGAATATTATTCTCGTCAGACTTAA

Network for GWHGAAZE010123

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0205

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00163.20	Ribosomal_S4	3	82	6.00E-21
PF01479.26	S4	83	130	4.60E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02986	RP-S4, rpsD	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0015935	cellular_component	small ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome
GO:0003723	molecular_function	RNA binding
GO:0019843	molecular_function	rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.386
	SRR3591706	second leaf	1.284
	SRR3591707	mature leaf	0.251
	SRR3591708	Shoot apex	1.471
	SRR3591709	Stem	0.356
	SRR3591710	White floral bud	0.102
	SRR3591711	White flower	0.178
	SRR3591712	Green floral bud	0.569
	SRR3591713	Yellow flower	0.466
SRP173429	SRR8316895	Juvenile bud stage	5.524
	SRR8316896	Juvenile bud stage	2.679
	SRR8316897	Juvenile bud stage	8.688
	SRR8316894	Third green stage	7.022
	SRR8316900	Third green stage	2.435
	SRR8316901	Third green stage	1.659
	SRR8316898	Complete white stage	3.488
	SRR8316899	Complete white stage	1.384
	SRR8316903	Complete white stage	2.560
	SRR8316902	Silver flowering stage	4.968
	SRR8316904	Silver flowering stage	4.783
	SRR8316905	Silver flowering stage	4.174
	SRR8316906	Gold flowering stage	1.668
	SRR8316907	Gold flowering stage	1.443
	SRR8316908	Gold flowering stage	1.551
SRP132670	SRR6706286	Control	0.529
	SRR6706287	Light intensity 50%	0.521
	SRR6706288	Light intensity 20%	0.383
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	21.186
	CNS0095593	Slightly white alabastrum(diploid) 2	17.649
	CNS0095594	Slightly white alabastrum(diploid) 3	26.899
	CNS0095595	Whole white alabastrum(diploid) 2	20.034
	CNS0095596	Whole white alabastrum(diploid) 3	13.304
	CNS0095597	Whole white alabastrum(diploid) 4	21.534
	CNS0095598	Silvery flower (diploied) 1	12.693
	CNS0095599	Silvery flower (diploied) 2	11.974
	CNS0095600	Silvery flower (diploied) 3	3.091
	CNS0095601	Golden flower (diploid) 1	13.515
	CNS0095602	Golden flower (diploid) 2	2.983
	CNS0095603	Golden flower (diploid) 3	2.552
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.670
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.126
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.488
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.551
	CNS0095608	Whole white alabastrum(tetraploid) 2	17.226
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.366
	CNS0095610	Silvery flower (tetraploid) 1	2.529
	CNS0095611	Silvery flower (tetraploid) 2	2.220
	CNS0095612	Silvery flower (tetraploid) 3	1.955
	CNS0095613	Golden flower (tetraploid) 1	5.387
	CNS0095614	Golden flower (tetraploid) 2	2.445
	CNS0095615	Golden flower (tetraploid) 3	2.364
CRA001975	CRR073297	Stem 1	3.922
	CRR073298	Stem 2	5.938
	CRR073299	Stem 3	1.524
	CRR073300	Leaf 1	3.463
	CRR073301	Leaf 2	2.837
	CRR073302	Leaf 3	1.902
	CRR073303	Juvenile bud 1	4.618
	CRR073304	Juvenile bud 2	2.112
	CRR073305	Juvenile bud 3	5.206
	CRR073306	Third green 1	3.083
	CRR073307	Third green 2	1.318
	CRR073308	Third green 3	4.096
	CRR073309	Second white 1	5.656
	CRR073310	Second white 2	6.958
	CRR073311	Second white 3	5.704
	CRR073312	Silver flowering 1	5.977
	CRR073313	Silver flowering 2	0.465
	CRR073314	Silver flowering 3	2.774
	CRR073315	Gold flowering 1	17.528
	CRR073316	Gold flowering 2	18.755
	CRR073317	Gold flowering 3	13.835
	CRR073318	Tawny withering 1	2.504
	CRR073319	Tawny withering 2	5.988
	CRR073320	Tawny withering 3	2.053