Gene detail

Detail information of GWHGAAZE010134

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_001001565.1	2.05926E-93	cytochrome b6/f complex subunit IV [Nuphar advena]
Swissprot	tr\|Q6EW21\|PETD_NYMAL	1E-95	Cytochrome b6-f complex subunit 4 {ECO:0000255\|HAMAP-Rule:MF_01344}
trEMBL	tr\|Q4FFW3\|Q4FFW3_RANMC	2E-93	Cytochrome b6/f complex subunit IV {ECO:0000313\|EMBL:AAZ04006.1} (Fragment)
TAIR10	ATCG00730.1	1E-74	photosynthetic electron transfer D

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123753226	123753645	+
GWHAAZE00000002	mRNA	123753226	123753645	+
GWHAAZE00000002	exon	123753226	123753645	+
GWHAAZE00000002	CDS	123753226	123753645	+

Transcript Sequence
>GWHTAAZE010146 ATGGGTCATAATTATTACGGAGAGCCCGCGTGGCCTAATGATCTTTTATATATTTTTCCTGTAGTCATTCTAGGTACTATTGCATGTAACGTAGGCTTAGCGGTTCTAGAACCATCAATGATTGGTGAACCAGCAGATCCATTTGCAACCCCTTTAGAAATATTACCCGAATGGTATTTCTTTCCCGTATTTCAAATACTTCGTACAGTACCCAATAAATTATTGGGTGTTCTTTTAATGGTTTCAGTACCCGCGGGATTATTAACAGTACCTTTTTTAGAGAATGTTAATAAATTTCAAAATCCATTTCGTCGTCCAGTAGCGACAACGGTCTTTTTGATTGGTACCGCAGTGGCCCTTTGGTTGGGTATTGGTGCAACATTACCTATTGATAAATCCCTAACTTTAGGTCTTTTTTAA

Network for GWHGAAZE010134

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00032.18	Cytochrom_B_C	44	132	1.00E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02637	petD	Metabolic pathways	map01100
K02637	petD	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0009767	biological_process	photosynthetic electron transport chain
GO:0016020	cellular_component	membrane
GO:0042651	cellular_component	thylakoid membrane
GO:0009055	molecular_function	electron transfer activity
GO:0016491	molecular_function	oxidoreductase activity
GO:0045156	molecular_function	electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.815
	SRR3591706	second leaf	3.726
	SRR3591707	mature leaf	3.911
	SRR3591708	Shoot apex	3.287
	SRR3591709	Stem	0.475
	SRR3591710	White floral bud	0.490
	SRR3591711	White flower	0.137
	SRR3591712	Green floral bud	0.316
	SRR3591713	Yellow flower	1.114
SRP173429	SRR8316895	Juvenile bud stage	15.850
	SRR8316896	Juvenile bud stage	8.304
	SRR8316897	Juvenile bud stage	31.320
	SRR8316894	Third green stage	21.782
	SRR8316900	Third green stage	2.975
	SRR8316901	Third green stage	1.773
	SRR8316898	Complete white stage	10.779
	SRR8316899	Complete white stage	1.001
	SRR8316903	Complete white stage	5.800
	SRR8316902	Silver flowering stage	11.317
	SRR8316904	Silver flowering stage	15.574
	SRR8316905	Silver flowering stage	7.362
	SRR8316906	Gold flowering stage	1.499
	SRR8316907	Gold flowering stage	0.391
	SRR8316908	Gold flowering stage	1.095
SRP132670	SRR6706286	Control	0.779
	SRR6706287	Light intensity 50%	0.634
	SRR6706288	Light intensity 20%	0.786
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.342
	CNS0095593	Slightly white alabastrum(diploid) 2	5.570
	CNS0095594	Slightly white alabastrum(diploid) 3	8.293
	CNS0095595	Whole white alabastrum(diploid) 2	11.872
	CNS0095596	Whole white alabastrum(diploid) 3	7.909
	CNS0095597	Whole white alabastrum(diploid) 4	11.500
	CNS0095598	Silvery flower (diploied) 1	10.065
	CNS0095599	Silvery flower (diploied) 2	5.807
	CNS0095600	Silvery flower (diploied) 3	4.183
	CNS0095601	Golden flower (diploid) 1	8.127
	CNS0095602	Golden flower (diploid) 2	3.488
	CNS0095603	Golden flower (diploid) 3	2.919
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.777
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.026
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.507
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.593
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.374
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.642
	CNS0095610	Silvery flower (tetraploid) 1	2.686
	CNS0095611	Silvery flower (tetraploid) 2	5.425
	CNS0095612	Silvery flower (tetraploid) 3	4.175
	CNS0095613	Golden flower (tetraploid) 1	7.504
	CNS0095614	Golden flower (tetraploid) 2	4.790
	CNS0095615	Golden flower (tetraploid) 3	3.742
CRA001975	CRR073297	Stem 1	1.775
	CRR073298	Stem 2	2.886
	CRR073299	Stem 3	1.163
	CRR073300	Leaf 1	0.689
	CRR073301	Leaf 2	1.343
	CRR073302	Leaf 3	0.958
	CRR073303	Juvenile bud 1	3.027
	CRR073304	Juvenile bud 2	0.808
	CRR073305	Juvenile bud 3	1.655
	CRR073306	Third green 1	1.621
	CRR073307	Third green 2	1.280
	CRR073308	Third green 3	0.491
	CRR073309	Second white 1	2.351
	CRR073310	Second white 2	7.259
	CRR073311	Second white 3	11.635
	CRR073312	Silver flowering 1	9.540
	CRR073313	Silver flowering 2	0.666
	CRR073314	Silver flowering 3	4.161
	CRR073315	Gold flowering 1	22.809
	CRR073316	Gold flowering 2	19.020
	CRR073317	Gold flowering 3	22.846
	CRR073318	Tawny withering 1	2.627
	CRR073319	Tawny withering 2	2.311
	CRR073320	Tawny withering 3	2.476