Gene detail

Detail information of GWHGAAZE010135

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31216.1	0	RNA polymerase alpha subunit protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q68RX5\|RPOA_PANGI	0	DNA-directed RNA polymerase subunit alpha {ECO:0000255\|HAMAP-Rule:MF_00059}
trEMBL	tr\|D3WBT4\|D3WBT4_LONJA	0	RNA polymerase alpha subunit protein {ECO:0000313\|EMBL:ADD31216.1}
TAIR10	ATCG00740.1	3E-126	RNA polymerase subunit alpha

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123754072	123754866	-
GWHAAZE00000002	mRNA	123754072	123754866	-
GWHAAZE00000002	exon	123754072	123754866	-
GWHAAZE00000002	CDS	123754072	123754866	-

Transcript Sequence
>GWHTAAZE010147 ATGGTTCAAGAGAAAGTAACAGTATCTACTCGGACACTAGAGTGGAAGTGCGTTGAATCAAGAGCAGACAGTAAGCGTCTTTATTATGGACGCTTTATTCTGTCTCCACTTATGAAAGGTCAAGCTGACACAATAGGCATTGCGATGCGAAGAGCTTTGCTTGGAGAAATAGAAGGAACATGCATCACACGCGCAAAATCTGAGAAAATACCACATGAATATTCTACCATAGTGGGTATTCAAGAATCAGTACATGAAATTTTAATGAATTTGAAAGAAATTGTATTGAGAAGTAATCTATATGGAACCTGCGACGCGTCCATTTGTGTCAGGGGTCCCGGAAATGTAACTGCTCAAGATATCATCTCACCGCCCTATGTCGAAATCATTGATAATACACAGCATATAGTTAGCTTGACGGAACCAATTGATTTTTGTATTGGATTACAAATCGAGAGGAATCGTGGATATCTTATAAAAACGCCAAATCATTTTCAAGATGGAAGTTATCCCATAGATGCTGTATTCATGCCTGTTCGAAATGCGAATCATAGTATTCATTCTTATGGGAATGAGAATGAGAAACAAGAAATACTCTTTCTCGAAATATGGACAAACGGAAGTTTAACTCCTAAAGAAGCACTTCATGAAGCCTCTCGGAATTTGATTGATTTATTTATTCCTTTTTTACATACAGAAGAAGAAAATTTACATTTAGAGGACAATCAACACACGGTTCCTTTAACCCCCTTTACCTTTCATGAGAAATTGGCTAAACTAAGAAAAAAAAAATAG

Network for GWHGAAZE010135

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0053

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01193.25	RNA_pol_L	35	225	3.50E-12
PF01000.27	RNA_pol_A_bac	66	157	1.10E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03040	rpoA	RNA polymerase	map03020

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0046983	molecular_function	protein dimerization activity
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.907
	SRR3591706	second leaf	0.556
	SRR3591707	mature leaf	1.183
	SRR3591708	Shoot apex	0.985
	SRR3591709	Stem	0.373
	SRR3591710	White floral bud	0.365
	SRR3591711	White flower	0.300
	SRR3591712	Green floral bud	0.405
	SRR3591713	Yellow flower	0.446
SRP173429	SRR8316895	Juvenile bud stage	5.577
	SRR8316896	Juvenile bud stage	2.727
	SRR8316897	Juvenile bud stage	8.300
	SRR8316894	Third green stage	8.264
	SRR8316900	Third green stage	1.533
	SRR8316901	Third green stage	0.766
	SRR8316898	Complete white stage	1.443
	SRR8316899	Complete white stage	0.813
	SRR8316903	Complete white stage	1.557
	SRR8316902	Silver flowering stage	2.790
	SRR8316904	Silver flowering stage	3.134
	SRR8316905	Silver flowering stage	3.125
	SRR8316906	Gold flowering stage	0.902
	SRR8316907	Gold flowering stage	0.727
	SRR8316908	Gold flowering stage	0.782
SRP132670	SRR6706286	Control	0.382
	SRR6706287	Light intensity 50%	0.409
	SRR6706288	Light intensity 20%	0.550
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.049
	CNS0095593	Slightly white alabastrum(diploid) 2	3.486
	CNS0095594	Slightly white alabastrum(diploid) 3	3.872
	CNS0095595	Whole white alabastrum(diploid) 2	5.937
	CNS0095596	Whole white alabastrum(diploid) 3	3.762
	CNS0095597	Whole white alabastrum(diploid) 4	6.721
	CNS0095598	Silvery flower (diploied) 1	3.900
	CNS0095599	Silvery flower (diploied) 2	2.956
	CNS0095600	Silvery flower (diploied) 3	3.034
	CNS0095601	Golden flower (diploid) 1	4.323
	CNS0095602	Golden flower (diploid) 2	2.489
	CNS0095603	Golden flower (diploid) 3	2.270
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.781
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.396
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.663
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.803
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.560
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.420
	CNS0095610	Silvery flower (tetraploid) 1	2.333
	CNS0095611	Silvery flower (tetraploid) 2	3.373
	CNS0095612	Silvery flower (tetraploid) 3	2.495
	CNS0095613	Golden flower (tetraploid) 1	2.466
	CNS0095614	Golden flower (tetraploid) 2	2.143
	CNS0095615	Golden flower (tetraploid) 3	3.216
CRA001975	CRR073297	Stem 1	3.448
	CRR073298	Stem 2	5.136
	CRR073299	Stem 3	2.129
	CRR073300	Leaf 1	2.882
	CRR073301	Leaf 2	3.372
	CRR073302	Leaf 3	2.081
	CRR073303	Juvenile bud 1	2.526
	CRR073304	Juvenile bud 2	1.512
	CRR073305	Juvenile bud 3	3.062
	CRR073306	Third green 1	1.797
	CRR073307	Third green 2	1.162
	CRR073308	Third green 3	2.252
	CRR073309	Second white 1	2.024
	CRR073310	Second white 2	8.031
	CRR073311	Second white 3	8.103
	CRR073312	Silver flowering 1	5.817
	CRR073313	Silver flowering 2	0.831
	CRR073314	Silver flowering 3	3.223
	CRR073315	Gold flowering 1	7.008
	CRR073316	Gold flowering 2	8.661
	CRR073317	Gold flowering 3	6.640
	CRR073318	Tawny withering 1	3.555
	CRR073319	Tawny withering 2	2.186
	CRR073320	Tawny withering 3	1.998