Gene detail

Detail information of GWHGAAZE010136

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD30128.1	2.6085E-92	ribosomal protein S11 (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q68RX4\|RR11_PANGI	5E-85	30S ribosomal protein S11, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01310}
trEMBL	tr\|D3WBT8\|D3WBT8_LONJA	1E-92	30S ribosomal protein S11, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01310}
TAIR10	ATCG00750.1	9E-54	ribosomal protein S11

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123754941	123755357	-
GWHAAZE00000002	mRNA	123754941	123755357	-
GWHAAZE00000002	exon	123754941	123755357	-
GWHAAZE00000002	CDS	123754941	123755357	-

Transcript Sequence
>GWHTAAZE010148 ATGGCAAAAGCTATACCGAGAATTGGTTCACATAGGAAGGGACGTTTTGGTTCACGTAAGAGTACACGCCGAATACCAAAGGGAGTTATTCATGTTCAAGCAAGTTTCCATAATACCATTGTGACTGTTACAGATGTACGGGGTCAAGTAGTTTCTTGGTCCTCTGCCGGTACTTGTGGATTCAGAGGTAGAAGAAGAGGGACACCGTTTGCTGCTCAAACCATAGCAGGAAATGCGATTCGTACAGTAGTAGATCAAGGTATGAAACGAGCCAACGTCATGATAAAGGGTCCTGGTCTCGGAAGAGACGCAGCATTGCGAGCTATTCGCAGAAGCGGCATACTATTAACTTTCATACGTGATGTAACCCCCCTCCCACATAATGGCTGTAGACCTCCGAAAAGAAGACGTGTGTAG

Network for GWHGAAZE010136

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00411.20	Ribosomal_S11	28	137	1.20E-48

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02948	RP-S11, MRPS11, rpsK	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.711
	SRR3591706	second leaf	1.081
	SRR3591707	mature leaf	0.960
	SRR3591708	Shoot apex	1.567
	SRR3591709	Stem	0.432
	SRR3591710	White floral bud	0.393
	SRR3591711	White flower	0.199
	SRR3591712	Green floral bud	0.714
	SRR3591713	Yellow flower	0.633
SRP173429	SRR8316895	Juvenile bud stage	9.162
	SRR8316896	Juvenile bud stage	6.072
	SRR8316897	Juvenile bud stage	11.457
	SRR8316894	Third green stage	14.106
	SRR8316900	Third green stage	2.918
	SRR8316901	Third green stage	1.593
	SRR8316898	Complete white stage	2.857
	SRR8316899	Complete white stage	0.957
	SRR8316903	Complete white stage	3.515
	SRR8316902	Silver flowering stage	4.992
	SRR8316904	Silver flowering stage	4.758
	SRR8316905	Silver flowering stage	4.596
	SRR8316906	Gold flowering stage	1.253
	SRR8316907	Gold flowering stage	1.712
	SRR8316908	Gold flowering stage	1.863
SRP132670	SRR6706286	Control	0.624
	SRR6706287	Light intensity 50%	1.321
	SRR6706288	Light intensity 20%	1.187
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.775
	CNS0095593	Slightly white alabastrum(diploid) 2	12.148
	CNS0095594	Slightly white alabastrum(diploid) 3	13.004
	CNS0095595	Whole white alabastrum(diploid) 2	12.301
	CNS0095596	Whole white alabastrum(diploid) 3	12.205
	CNS0095597	Whole white alabastrum(diploid) 4	13.784
	CNS0095598	Silvery flower (diploied) 1	7.287
	CNS0095599	Silvery flower (diploied) 2	6.177
	CNS0095600	Silvery flower (diploied) 3	5.175
	CNS0095601	Golden flower (diploid) 1	6.264
	CNS0095602	Golden flower (diploid) 2	5.218
	CNS0095603	Golden flower (diploid) 3	5.187
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.992
	CNS0095605	Slightly white alabastrum(tetraploid) 2	9.946
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.528
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.899
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.872
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.295
	CNS0095610	Silvery flower (tetraploid) 1	3.929
	CNS0095611	Silvery flower (tetraploid) 2	6.819
	CNS0095612	Silvery flower (tetraploid) 3	4.815
	CNS0095613	Golden flower (tetraploid) 1	5.080
	CNS0095614	Golden flower (tetraploid) 2	4.681
	CNS0095615	Golden flower (tetraploid) 3	4.399
CRA001975	CRR073297	Stem 1	31.029
	CRR073298	Stem 2	32.012
	CRR073299	Stem 3	17.539
	CRR073300	Leaf 1	23.769
	CRR073301	Leaf 2	30.183
	CRR073302	Leaf 3	14.112
	CRR073303	Juvenile bud 1	23.966
	CRR073304	Juvenile bud 2	21.232
	CRR073305	Juvenile bud 3	20.469
	CRR073306	Third green 1	16.082
	CRR073307	Third green 2	9.335
	CRR073308	Third green 3	21.663
	CRR073309	Second white 1	7.110
	CRR073310	Second white 2	21.793
	CRR073311	Second white 3	24.039
	CRR073312	Silver flowering 1	17.178
	CRR073313	Silver flowering 2	3.141
	CRR073314	Silver flowering 3	10.541
	CRR073315	Gold flowering 1	33.374
	CRR073316	Gold flowering 2	36.683
	CRR073317	Gold flowering 3	16.924
	CRR073318	Tawny withering 1	11.564
	CRR073319	Tawny withering 2	7.393
	CRR073320	Tawny withering 3	6.954