Gene detail

Detail information of GWHGAAZE010137

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD30348.1	1.08024E-82	ribosomal protein L14 (chloroplast) [Lonicera japonica]
Swissprot	tr\|A0A372\|RK14_COFAR	7E-81	50S ribosomal protein L14, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01367}
trEMBL	tr\|D3WBS5\|D3WBS5_LONJA	4E-83	50S ribosomal protein L14, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01367, ECO:0000256\|RuleBase:RU003951}
TAIR10	ATCG00780.1	2E-61	ribosomal protein L14

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123756647	123757015	-
GWHAAZE00000002	mRNA	123756647	123757015	-
GWHAAZE00000002	exon	123756647	123757015	-
GWHAAZE00000002	CDS	123756647	123757015	-

Transcript Sequence
>GWHTAAZE010149 ATGATTCAACCTCAGACCTATTTGAATGTAGCGGATAACAGCGGGGCTCGAGAATTGATGTGTATTCGAATCATAGGAGCTAGCAATCGCCGATATGCTCATATTGGTGACGTTATTGTTGCTGTGATTAAAGAAGCAGTGCCAAAGATGCCCCTAGAAAGATCAGAAGTGGTCAGAGCTGTAATTGTACGTACTTGTAAAGAACTCAAACGTGACAGCGGTATGATAATACGATATGATGACAATGCTGCAGTCCTCATTGATCAAGAAGGAAATCCAAAGGGAACTCGGGTTTTTGGTGCGATTGCCGGGGAGTTGAGACAGTTAAATTTTACTAAAATAGTTTCATTAGCTCCCGAGGTATTATAA

Network for GWHGAAZE010137

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00238.20	Ribosomal_L14	1	122	1.80E-49

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02874	RP-L14, MRPL14, rplN	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0015934	cellular_component	large ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.589
	SRR3591706	second leaf	1.811
	SRR3591707	mature leaf	2.523
	SRR3591708	Shoot apex	4.109
	SRR3591709	Stem	0.566
	SRR3591710	White floral bud	0.737
	SRR3591711	White flower	0.788
	SRR3591712	Green floral bud	2.395
	SRR3591713	Yellow flower	1.062
SRP173429	SRR8316895	Juvenile bud stage	14.109
	SRR8316896	Juvenile bud stage	11.865
	SRR8316897	Juvenile bud stage	19.093
	SRR8316894	Third green stage	20.650
	SRR8316900	Third green stage	6.954
	SRR8316901	Third green stage	4.008
	SRR8316898	Complete white stage	4.174
	SRR8316899	Complete white stage	3.906
	SRR8316903	Complete white stage	2.462
	SRR8316902	Silver flowering stage	6.680
	SRR8316904	Silver flowering stage	8.417
	SRR8316905	Silver flowering stage	6.549
	SRR8316906	Gold flowering stage	2.707
	SRR8316907	Gold flowering stage	3.219
	SRR8316908	Gold flowering stage	3.056
SRP132670	SRR6706286	Control	0.706
	SRR6706287	Light intensity 50%	1.051
	SRR6706288	Light intensity 20%	1.433
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	35.883
	CNS0095593	Slightly white alabastrum(diploid) 2	28.014
	CNS0095594	Slightly white alabastrum(diploid) 3	34.048
	CNS0095595	Whole white alabastrum(diploid) 2	30.375
	CNS0095596	Whole white alabastrum(diploid) 3	26.255
	CNS0095597	Whole white alabastrum(diploid) 4	27.789
	CNS0095598	Silvery flower (diploied) 1	20.969
	CNS0095599	Silvery flower (diploied) 2	14.640
	CNS0095600	Silvery flower (diploied) 3	11.949
	CNS0095601	Golden flower (diploid) 1	14.284
	CNS0095602	Golden flower (diploid) 2	12.584
	CNS0095603	Golden flower (diploid) 3	9.232
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.813
	CNS0095605	Slightly white alabastrum(tetraploid) 2	24.865
	CNS0095606	Slightly white alabastrum(tetraploid) 3	16.202
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.411
	CNS0095608	Whole white alabastrum(tetraploid) 2	27.389
	CNS0095609	Whole white alabastrum(tetraploid) 3	13.259
	CNS0095610	Silvery flower (tetraploid) 1	7.884
	CNS0095611	Silvery flower (tetraploid) 2	15.543
	CNS0095612	Silvery flower (tetraploid) 3	8.204
	CNS0095613	Golden flower (tetraploid) 1	9.197
	CNS0095614	Golden flower (tetraploid) 2	7.913
	CNS0095615	Golden flower (tetraploid) 3	9.415
CRA001975	CRR073297	Stem 1	36.878
	CRR073298	Stem 2	34.821
	CRR073299	Stem 3	17.912
	CRR073300	Leaf 1	21.864
	CRR073301	Leaf 2	18.446
	CRR073302	Leaf 3	13.244
	CRR073303	Juvenile bud 1	19.306
	CRR073304	Juvenile bud 2	12.573
	CRR073305	Juvenile bud 3	18.872
	CRR073306	Third green 1	7.568
	CRR073307	Third green 2	7.101
	CRR073308	Third green 3	11.987
	CRR073309	Second white 1	6.933
	CRR073310	Second white 2	24.083
	CRR073311	Second white 3	22.251
	CRR073312	Silver flowering 1	9.932
	CRR073313	Silver flowering 2	4.047
	CRR073314	Silver flowering 3	10.020
	CRR073315	Gold flowering 1	104.167
	CRR073316	Gold flowering 2	138.803
	CRR073317	Gold flowering 3	27.429
	CRR073318	Tawny withering 1	23.326
	CRR073319	Tawny withering 2	25.565
	CRR073320	Tawny withering 3	14.999