Gene detail

Detail information of GWHGAAZE010148

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AEX01588.1	1.4728E-162	photosystem II D2, partial [Posidonia australis]
Swissprot	tr\|A4QKA0\|PSBD_BARVE	2E-164	Photosystem II D2 protein {ECO:0000255\|HAMAP-Rule:MF_01383}
trEMBL	tr\|H6TH67\|H6TH67_9LILI	5E-163	Photosystem II D2 protein {ECO:0000256\|RuleBase:RU004333} (Fragment)
TAIR10	ATCG00270.1	1E-123	photosystem II reaction center protein D

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123794832	123795515	-
GWHAAZE00000002	mRNA	123794832	123795515	-
GWHAAZE00000002	exon	123794832	123795515	-
GWHAAZE00000002	CDS	123794832	123795515	-

Transcript Sequence
>GWHTAAZE010160 ATGTTACGTCAATTCGAACTTGCTCGATCTGTTCAATTGCGACCTTATAATGCAATCGCATTCTCTGGCCCAATTGCTGTTTTTGTTTCTGTATTCCTGATTTATCCACTAGGTCAGTCTGGTTGGTTCTTTGCACCTAGTTTTGGTGTAGCGGCTATATTCCGATTCATCCTCTTTTTTCAAGGATTTCATAATTGGACGTTGAACCCATTTCATATGATGGGAGTTGCCGGTGTATTGGGCGCTGCTTTGCTATGCGCTATTCATGGTGCTACCGTAGAAAATACTTTATTTGAAGATGGTGATGGTGCAAATACATTCCGTGCGTTTAACCCAACCCAAGCTGAAGAAACTTATTCAATGGTCACCGCTAACCGCTTTTGGTCCCAAATCTTTGGGGTTGCTTTTTCCAATAAACGTTGGTTACATTTCTTTATGTTATTTGTACCAGTAACCGGTTTATGGATGAGTGCTCTTGGAGTAGTCGGTCTGGCTCTGAACCTGCGTGCCTATGACTTCGTTTCTCAGGAAATTCGTGCGGCTGAAGATCCTGAATTTGAGACTTTCTACACCAAAAATATTCTCTTAAACGAAGGGATTCGTGCTTGGATGGCGGCTCAAGATCAGCCTCATGAAAACCTTATATTCCCTGAGGAGGTTCTACCCCGTGGAAACGCTCTTTAA

Network for GWHGAAZE010148

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00124.20	Photo_RC	1	192	9.50E-56

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02706	psbD	Metabolic pathways	map01100
K02706	psbD	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0009772	biological_process	photosynthetic electron transport in photosystem II
GO:0019684	biological_process	photosynthesis, light reaction
GO:0045156	molecular_function	electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.122
	SRR3591706	second leaf	3.289
	SRR3591707	mature leaf	3.512
	SRR3591708	Shoot apex	2.365
	SRR3591709	Stem	0.978
	SRR3591710	White floral bud	0.263
	SRR3591711	White flower	0.863
	SRR3591712	Green floral bud	0.458
	SRR3591713	Yellow flower	0.597
SRP173429	SRR8316895	Juvenile bud stage	25.779
	SRR8316896	Juvenile bud stage	10.506
	SRR8316897	Juvenile bud stage	43.788
	SRR8316894	Third green stage	33.072
	SRR8316900	Third green stage	3.253
	SRR8316901	Third green stage	2.585
	SRR8316898	Complete white stage	11.926
	SRR8316899	Complete white stage	0.957
	SRR8316903	Complete white stage	10.817
	SRR8316902	Silver flowering stage	20.299
	SRR8316904	Silver flowering stage	18.512
	SRR8316905	Silver flowering stage	17.030
	SRR8316906	Gold flowering stage	1.071
	SRR8316907	Gold flowering stage	1.167
	SRR8316908	Gold flowering stage	0.954
SRP132670	SRR6706286	Control	0.785
	SRR6706287	Light intensity 50%	0.932
	SRR6706288	Light intensity 20%	0.749
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.572
	CNS0095593	Slightly white alabastrum(diploid) 2	12.262
	CNS0095594	Slightly white alabastrum(diploid) 3	13.830
	CNS0095595	Whole white alabastrum(diploid) 2	14.703
	CNS0095596	Whole white alabastrum(diploid) 3	10.112
	CNS0095597	Whole white alabastrum(diploid) 4	9.988
	CNS0095598	Silvery flower (diploied) 1	12.258
	CNS0095599	Silvery flower (diploied) 2	15.203
	CNS0095600	Silvery flower (diploied) 3	8.465
	CNS0095601	Golden flower (diploid) 1	16.593
	CNS0095602	Golden flower (diploid) 2	4.087
	CNS0095603	Golden flower (diploid) 3	6.293
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.557
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.975
	CNS0095606	Slightly white alabastrum(tetraploid) 3	5.272
	CNS0095607	Whole white alabastrum(tetraploid) 1	13.159
	CNS0095608	Whole white alabastrum(tetraploid) 2	13.910
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.858
	CNS0095610	Silvery flower (tetraploid) 1	7.287
	CNS0095611	Silvery flower (tetraploid) 2	8.722
	CNS0095612	Silvery flower (tetraploid) 3	7.065
	CNS0095613	Golden flower (tetraploid) 1	22.848
	CNS0095614	Golden flower (tetraploid) 2	10.194
	CNS0095615	Golden flower (tetraploid) 3	6.422
CRA001975	CRR073297	Stem 1	17.199
	CRR073298	Stem 2	19.647
	CRR073299	Stem 3	7.846
	CRR073300	Leaf 1	7.108
	CRR073301	Leaf 2	6.621
	CRR073302	Leaf 3	5.732
	CRR073303	Juvenile bud 1	10.035
	CRR073304	Juvenile bud 2	6.239
	CRR073305	Juvenile bud 3	15.746
	CRR073306	Third green 1	16.280
	CRR073307	Third green 2	6.042
	CRR073308	Third green 3	15.173
	CRR073309	Second white 1	25.015
	CRR073310	Second white 2	61.129
	CRR073311	Second white 3	130.101
	CRR073312	Silver flowering 1	96.879
	CRR073313	Silver flowering 2	37.945
	CRR073314	Silver flowering 3	51.747
	CRR073315	Gold flowering 1	169.955
	CRR073316	Gold flowering 2	239.184
	CRR073317	Gold flowering 3	366.349
	CRR073318	Tawny withering 1	6.440
	CRR073319	Tawny withering 2	7.447
	CRR073320	Tawny withering 3	6.418