Gene detail

Detail information of GWHGAAZE010162

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31333.1	4.0346E-119	NADH-plastoquinone oxidoreductase subunit 6 protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q06R77\|NU6C_JASNU	1E-108	NAD(P)H-quinone oxidoreductase subunit 6, chloroplastic
trEMBL	tr\|D3WBP3\|D3WBP3_LONJA	2E-119	NAD(P)H-quinone oxidoreductase subunit 6, chloroplastic {ECO:0000256\|RuleBase:RU004431}
TAIR10	ATCG01080.1	1E-57	NADH:ubiquinone/plastoquinone oxidoreductase, chain 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123861657	123862187	-
GWHAAZE00000002	mRNA	123861657	123862187	-
GWHAAZE00000002	exon	123861657	123862187	-
GWHAAZE00000002	CDS	123861657	123862187	-

Transcript Sequence
>GWHTAAZE010174 ATGGATTTACCTGGACCAATACATGATTTTCTTTTAGTCTTTCTGGGATTGGGTTTTATATTAGGAGGTCTAGGAGTGGTGTTACTTCCCAATCCAATTTATTCTGCCTTTTCGCTGGGATTGGTTCTTGTTTGTATATCCTTATTCTATATTCTATCGAATTCCTATTTTGTCGCTGCTGCGCAGCTCCTTATTTACGTAGGGGCCATAAATGTTTTAATCATTTTTGCTGTGATGTTCATGAAGGGTTCAGAATATTACAAGGATTTTCATCTTTTGGCCGTTGGGGATGGGCTTACTGCGATGGTTTGTACAAGTCTTTTTGTTTCACTAATTACTACTATTCCAGATACGTCGTGGTACGGGATTCTTTGGACTACAAAATCAAGCCAAATTATAGAGCAAGATTTGATAAGTAATAGTCAACAAATTGGGATTCATTTATCAACAGATTTTTTTCTTCCGTTTGAACTCATTTCAATAATTCTTTTAGTTTCGTTAATAGGTGCAATTGCTGTAGCTCGTCAATAA

Network for GWHGAAZE010162

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00499.21	Oxidored_q3	23	172	1.60E-30

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05578	ndhG	Metabolic pathways	map01100
K05578	ndhG	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0008137	molecular_function	NADH dehydrogenase (ubiquinone) activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.276
	SRR3591706	second leaf	1.802
	SRR3591707	mature leaf	1.993
	SRR3591708	Shoot apex	1.533
	SRR3591709	Stem	0.459
	SRR3591710	White floral bud	0.082
	SRR3591711	White flower	0.482
	SRR3591712	Green floral bud	0.146
	SRR3591713	Yellow flower	0.540
SRP173429	SRR8316895	Juvenile bud stage	5.458
	SRR8316896	Juvenile bud stage	2.354
	SRR8316897	Juvenile bud stage	11.912
	SRR8316894	Third green stage	9.481
	SRR8316900	Third green stage	1.225
	SRR8316901	Third green stage	0.726
	SRR8316898	Complete white stage	1.315
	SRR8316899	Complete white stage	0.891
	SRR8316903	Complete white stage	2.346
	SRR8316902	Silver flowering stage	3.365
	SRR8316904	Silver flowering stage	3.792
	SRR8316905	Silver flowering stage	3.406
	SRR8316906	Gold flowering stage	0.752
	SRR8316907	Gold flowering stage	0.136
	SRR8316908	Gold flowering stage	0.577
SRP132670	SRR6706286	Control	0.187
	SRR6706287	Light intensity 50%	0.042
	SRR6706288	Light intensity 20%	0.079
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.738
	CNS0095593	Slightly white alabastrum(diploid) 2	2.879
	CNS0095594	Slightly white alabastrum(diploid) 3	2.423
	CNS0095595	Whole white alabastrum(diploid) 2	4.183
	CNS0095596	Whole white alabastrum(diploid) 3	2.121
	CNS0095597	Whole white alabastrum(diploid) 4	3.943
	CNS0095598	Silvery flower (diploied) 1	3.405
	CNS0095599	Silvery flower (diploied) 2	2.166
	CNS0095600	Silvery flower (diploied) 3	0.956
	CNS0095601	Golden flower (diploid) 1	2.824
	CNS0095602	Golden flower (diploid) 2	1.137
	CNS0095603	Golden flower (diploid) 3	1.409
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.786
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.747
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.330
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.035
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.115
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.730
	CNS0095610	Silvery flower (tetraploid) 1	1.077
	CNS0095611	Silvery flower (tetraploid) 2	1.107
	CNS0095612	Silvery flower (tetraploid) 3	0.811
	CNS0095613	Golden flower (tetraploid) 1	1.686
	CNS0095614	Golden flower (tetraploid) 2	0.807
	CNS0095615	Golden flower (tetraploid) 3	1.330
CRA001975	CRR073297	Stem 1	1.429
	CRR073298	Stem 2	1.386
	CRR073299	Stem 3	0.172
	CRR073300	Leaf 1	0.629
	CRR073301	Leaf 2	1.001
	CRR073302	Leaf 3	0.195
	CRR073303	Juvenile bud 1	0.242
	CRR073304	Juvenile bud 2	0.175
	CRR073305	Juvenile bud 3	0.826
	CRR073306	Third green 1	0.262
	CRR073307	Third green 2	0.247
	CRR073308	Third green 3	0.428
	CRR073309	Second white 1	0.968
	CRR073310	Second white 2	1.060
	CRR073311	Second white 3	2.107
	CRR073312	Silver flowering 1	0.641
	CRR073313	Silver flowering 2	0.812
	CRR073314	Silver flowering 3	0.101
	CRR073315	Gold flowering 1	1.201
	CRR073316	Gold flowering 2	4.529
	CRR073317	Gold flowering 3	1.837
	CRR073318	Tawny withering 1	0.400
	CRR073319	Tawny withering 2	0.093
	CRR073320	Tawny withering 3	0.084