Gene detail

Detail information of GWHGAAZE010164

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006843113.1	9.4038E-163	hypothetical protein AMTR_s00140p00081000 [Amborella trichopoda]
Swissprot	tr\|Q332S2\|NU1C_LACSA	3E-91	NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01350}
trEMBL	tr\|W1PA42\|W1PA42_AMBTC	4E-163	Uncharacterized protein {ECO:0000313\|EMBL:ERN04788.1}
TAIR10	ATCG01100.1	1E-62	NADH dehydrogenase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123864765	123865695	-
GWHAAZE00000002	mRNA	123864765	123865695	-
GWHAAZE00000002	exon	123865371	123865695	-
GWHAAZE00000002	exon	123864765	123865216	-
GWHAAZE00000002	CDS	123865371	123865695	-
GWHAAZE00000002	CDS	123864765	123865216	-

Transcript Sequence
>GWHTAAZE010176 ATGATTCAACAGGCTCTAGAAGGAATTCCGGGGGGGCCCTATGAGAATTTAGAAATCCGACGTTTTGATCCACTAAGAGATCCGAAATGGAATGATTTTGACTATCGATTTATTAGTAAAAAACCTTCTCCGACTTTTGAATTGTCGAAGCAAGAACTTTATGTGAGAGTTGAAGCCCCAAAAGGAGAATTGGGAATTTTTCTGATAGGGGATAAGAATGTTTTTCCTTGGAGATGGAAAATCCGACCACCGGGTTTTATCAATTTGCAAATTCTTCCTCAGCTAGTTAAAAGAATGAAATTGGCTGATATTATGACGATATTAGGAATCACAATAGGTGTACTAGTAATTGTTTGGTTAGAAAGAGAAATATCTGCAGGGATACAACAACGTATTGGACCCGAATACGCCGGTCCTTTTGGAATTCTTCAAGCTCTAGCAGATGGTACAAAATTACTTTTCAAAGAGAATCTTCTGCCATCTCGAGGAGATATTCGTTTATTCAGTATCGGACCATCCATCGCAGTCATATCAATTCTACTAAGTTATTTAGTAATTCCTTTTGGCTATCATCTTGTTCTAGCTGATCTCAGTATCGGTGTTTTTTTATGGATTGCAATTTCAAGTATTGCTCCCATTGGACTTCTTATGTCAGGATATGGATCAAATAATAAATATTCTTTTTTAGGCGGTTTACGAGCTGCTGCTCAATCAATTAGTTATGAAATCCCATTAACTCTATGTGTGTTATCAATATCTCTACGTGTGATTCGTTGA

Network for GWHGAAZE010164

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00346.20	Complex1_49kDa	1	109	7.70E-20
PF00146.22	NADHdh	105	254	4.70E-50

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05572	ndhA	Metabolic pathways	map01100
K05572	ndhA	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016020	cellular_component	membrane
GO:0016651	molecular_function	oxidoreductase activity, acting on NAD(P)H
GO:0048038	molecular_function	quinone binding
GO:0051287	molecular_function	NAD binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.392
	SRR3591706	second leaf	3.173
	SRR3591707	mature leaf	3.694
	SRR3591708	Shoot apex	2.151
	SRR3591709	Stem	0.424
	SRR3591710	White floral bud	0.033
	SRR3591711	White flower	0.048
	SRR3591712	Green floral bud	0.377
	SRR3591713	Yellow flower	0.225
SRP173429	SRR8316895	Juvenile bud stage	5.438
	SRR8316896	Juvenile bud stage	2.692
	SRR8316897	Juvenile bud stage	9.119
	SRR8316894	Third green stage	9.955
	SRR8316900	Third green stage	1.188
	SRR8316901	Third green stage	0.919
	SRR8316898	Complete white stage	2.031
	SRR8316899	Complete white stage	0.661
	SRR8316903	Complete white stage	1.556
	SRR8316902	Silver flowering stage	3.840
	SRR8316904	Silver flowering stage	2.918
	SRR8316905	Silver flowering stage	2.645
	SRR8316906	Gold flowering stage	0.664
	SRR8316907	Gold flowering stage	1.028
	SRR8316908	Gold flowering stage	0.850
SRP132670	SRR6706286	Control	0.009
	SRR6706287	Light intensity 50%	0.036
	SRR6706288	Light intensity 20%	0.043
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.433
	CNS0095593	Slightly white alabastrum(diploid) 2	2.610
	CNS0095594	Slightly white alabastrum(diploid) 3	3.438
	CNS0095595	Whole white alabastrum(diploid) 2	4.450
	CNS0095596	Whole white alabastrum(diploid) 3	2.836
	CNS0095597	Whole white alabastrum(diploid) 4	4.181
	CNS0095598	Silvery flower (diploied) 1	3.067
	CNS0095599	Silvery flower (diploied) 2	2.159
	CNS0095600	Silvery flower (diploied) 3	2.226
	CNS0095601	Golden flower (diploid) 1	2.737
	CNS0095602	Golden flower (diploid) 2	2.530
	CNS0095603	Golden flower (diploid) 3	2.258
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.293
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.869
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.607
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.107
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.698
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.970
	CNS0095610	Silvery flower (tetraploid) 1	2.346
	CNS0095611	Silvery flower (tetraploid) 2	2.089
	CNS0095612	Silvery flower (tetraploid) 3	2.080
	CNS0095613	Golden flower (tetraploid) 1	2.057
	CNS0095614	Golden flower (tetraploid) 2	1.353
	CNS0095615	Golden flower (tetraploid) 3	1.580
CRA001975	CRR073297	Stem 1	2.139
	CRR073298	Stem 2	2.564
	CRR073299	Stem 3	0.777
	CRR073300	Leaf 1	2.691
	CRR073301	Leaf 2	2.024
	CRR073302	Leaf 3	0.872
	CRR073303	Juvenile bud 1	1.063
	CRR073304	Juvenile bud 2	1.016
	CRR073305	Juvenile bud 3	1.145
	CRR073306	Third green 1	0.837
	CRR073307	Third green 2	0.344
	CRR073308	Third green 3	0.488
	CRR073309	Second white 1	0.807
	CRR073310	Second white 2	2.090
	CRR073311	Second white 3	2.178
	CRR073312	Silver flowering 1	1.567
	CRR073313	Silver flowering 2	0.552
	CRR073314	Silver flowering 3	1.269
	CRR073315	Gold flowering 1	6.134
	CRR073316	Gold flowering 2	8.409
	CRR073317	Gold flowering 3	3.568
	CRR073318	Tawny withering 1	2.271
	CRR073319	Tawny withering 2	1.597
	CRR073320	Tawny withering 3	0.523