Gene detail

Detail information of GWHGAAZE010171

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD30274.1	8.3811E-102	ribosomal protein L22 (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q332T7\|RK22_LACSA	3E-79	50S ribosomal protein L22, chloroplastic
trEMBL	tr\|D3WBS9\|D3WBS9_LONJA	3E-102	50S ribosomal protein L22, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01331, ECO:0000256\|RuleBase:RU004009}
TAIR10	ATCG00810.1	6E-49	ribosomal protein L22

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123891077	123891508	+
GWHAAZE00000002	mRNA	123891077	123891508	+
GWHAAZE00000002	exon	123891077	123891508	+
GWHAAZE00000002	CDS	123891077	123891508	+

Transcript Sequence
>GWHTAAZE010183 ATGTCTGCTCACAAAGCGCGAAGAGTAATTGATCAAATTCGTGGACGTTCCTACGAAGAAACACTTATGATACTAGAACTCATGCCTTATCGAGCATGTTATCCAATTTTTAAATTGGTTTATTCTGCAGCAGCAAATGCTAGTTACATTCTGGGTTCCAATGAAGCAAATTTAATCATTAGTAAAGCTGAAGTCAACGAGGGTACTGCCGTGAAGAAATTAAAACCTCGAGCTCGAGGACGTAGTTATCCGATAAAAAGACCTACCTGCCATATAACTATTATAGTGAAAGATATGTCCTTACCTGAATATGTAACGAAAAACTTTCTTGAATGGTCAAAAAAACCTAAATGGAAAAAATGGAAAAATAAGTATACAGATGTGACGTATCATGATATGTATAGTAATGGGGGAGTATGGGACAAAAAATAA

Network for GWHGAAZE010171

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0205

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00237.20	Ribosomal_L22	1	97	3.30E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02890	RP-L22, MRPL22, rplV	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0015934	cellular_component	large ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.099
	SRR3591706	second leaf	2.044
	SRR3591707	mature leaf	2.297
	SRR3591708	Shoot apex	7.356
	SRR3591709	Stem	1.430
	SRR3591710	White floral bud	0.832
	SRR3591711	White flower	1.487
	SRR3591712	Green floral bud	1.844
	SRR3591713	Yellow flower	1.261
SRP173429	SRR8316895	Juvenile bud stage	21.204
	SRR8316896	Juvenile bud stage	11.836
	SRR8316897	Juvenile bud stage	26.174
	SRR8316894	Third green stage	25.754
	SRR8316900	Third green stage	11.218
	SRR8316901	Third green stage	3.731
	SRR8316898	Complete white stage	6.747
	SRR8316899	Complete white stage	3.675
	SRR8316903	Complete white stage	6.094
	SRR8316902	Silver flowering stage	11.762
	SRR8316904	Silver flowering stage	12.137
	SRR8316905	Silver flowering stage	10.575
	SRR8316906	Gold flowering stage	3.941
	SRR8316907	Gold flowering stage	2.698
	SRR8316908	Gold flowering stage	2.500
SRP132670	SRR6706286	Control	0.775
	SRR6706287	Light intensity 50%	0.805
	SRR6706288	Light intensity 20%	0.583
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	56.951
	CNS0095593	Slightly white alabastrum(diploid) 2	36.539
	CNS0095594	Slightly white alabastrum(diploid) 3	63.700
	CNS0095595	Whole white alabastrum(diploid) 2	47.535
	CNS0095596	Whole white alabastrum(diploid) 3	30.202
	CNS0095597	Whole white alabastrum(diploid) 4	47.047
	CNS0095598	Silvery flower (diploied) 1	30.393
	CNS0095599	Silvery flower (diploied) 2	23.357
	CNS0095600	Silvery flower (diploied) 3	10.414
	CNS0095601	Golden flower (diploid) 1	30.773
	CNS0095602	Golden flower (diploid) 2	9.126
	CNS0095603	Golden flower (diploid) 3	9.266
	CNS0095604	Slightly white alabastrum(tetraploid) 1	25.317
	CNS0095605	Slightly white alabastrum(tetraploid) 2	33.119
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.014
	CNS0095607	Whole white alabastrum(tetraploid) 1	23.009
	CNS0095608	Whole white alabastrum(tetraploid) 2	34.015
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.468
	CNS0095610	Silvery flower (tetraploid) 1	6.961
	CNS0095611	Silvery flower (tetraploid) 2	10.602
	CNS0095612	Silvery flower (tetraploid) 3	5.031
	CNS0095613	Golden flower (tetraploid) 1	11.964
	CNS0095614	Golden flower (tetraploid) 2	6.435
	CNS0095615	Golden flower (tetraploid) 3	9.178
CRA001975	CRR073297	Stem 1	13.540
	CRR073298	Stem 2	20.392
	CRR073299	Stem 3	8.583
	CRR073300	Leaf 1	9.748
	CRR073301	Leaf 2	10.917
	CRR073302	Leaf 3	7.426
	CRR073303	Juvenile bud 1	9.948
	CRR073304	Juvenile bud 2	5.222
	CRR073305	Juvenile bud 3	6.499
	CRR073306	Third green 1	4.918
	CRR073307	Third green 2	2.039
	CRR073308	Third green 3	7.160
	CRR073309	Second white 1	5.483
	CRR073310	Second white 2	22.089
	CRR073311	Second white 3	19.357
	CRR073312	Silver flowering 1	9.373
	CRR073313	Silver flowering 2	2.694
	CRR073314	Silver flowering 3	10.878
	CRR073315	Gold flowering 1	60.959
	CRR073316	Gold flowering 2	53.944
	CRR073317	Gold flowering 3	11.166
	CRR073318	Tawny withering 1	21.029
	CRR073319	Tawny withering 2	28.439
	CRR073320	Tawny withering 3	17.147